Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS30a
Systematic Name YLR287C-A
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps30Bp and has similarity to rat S30 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS30A	6323318 upstream sequence, from -1000 to -1, size 1000
TATTAGACGTGTTGAACGGTACAGTAATGTCAACCACATTCATTTAATGGGAGTCAAAAA
AAAGGAGCATGGAAATGAAGGTGATGATGTAGAACTTAAGATAATTGTGAATGAATTAGA
TTGGCATTTGGAAATATGCTGGAATGGACCCTTAGACTCTGTGATACAACGCCAAGAAGG
GCTCACTGACAATCCTTCCCAAAACCAGCACATCGACACAGACGGCCGGCAGGAGGAAGG
ATCTCTTCCGATTATCGAAGCGGATAAACCGATGTCTTCACTATATACCAATACTAGAGA
TCGAGAGATGGAAGAAAATATCCGCTACGATGAAGATTTATTAAGAATTGAGGATAGCTC
GATCGCAGATACGCGGGGAAACATTTACACAGCTGATACTAGCGGTGATACTGAATTTAA
TGACATATCCGTTATGGTGGAAAAGGCTGAACAGGAAAGTTCGTCCACACATGAAGTAAT
CATCCGTTGCAAAGATTGGAAGGTGTGTTCCAAGTTATACGCTGCATTTGAAGAAGTTGT
TTTGGCGATTTCTCACGACGAATCCTGCGTATTCCACTGTTCGTTGGATCGTGGTAGCTT
GGAAGATAGCGAAGATGTGGAAAAACCAAGGGAAAGAGGACAAATCATATATTATATAGC
AAGATCGAAGGGCTTGTAAACCCTACAGCGGTACATTTCTTTGCTACGTTGCTAAGGAAA
CTCTTTAAATCTGACATGGCTGAGAACTGCAGAGTTGCAGAGTTGCAGACTATCACATCC
GTACATATGTATAAAAAAATCCGTGCTTTACATACTAACTGCTTTTCTTTTTTCCGTTCG
AAAAAAAAAAATGTCGTGAGGTTGTCGGAAACCTCAGAAAAAATAGATAGAACAAAACAG
CCTTACGAACGGTATGTTGCATTTTAAAGGCTACATGAACTGCACATTAAATTTGCCACT
GTAATAATCTTCCATATCCCCATACAAAAACTACGCAAAT
Chromosomal Coordinates Chr XII from 712725-712537,713158-713156
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator