Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RED1
Systematic Name YLR263W
Description Protein component of the synaptonemal complex axial elements, involved in chromosome segregation during the first meiotic division; critical for coupling checkpoint signaling to SC formation; interacts with Hop1p, Mec3p and Ddc1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RED1	6323293 upstream sequence, from -1000 to -1, size 1000
GATTGTAAAACATCGGAAAGAACGATATATCTTGCAAATAGCTTTTCTTTGGTAATATAT
GTATTTACTTAAAAAACGAGAACTAGAAAATACTGAGTAAATTTTTATTAGACGTTGTTA
AAGGCCTTTTATTTCTTACCAGATTTTTTGATACCACCACCCACTAAAGGTTTACCACTT
TTCATATTAGCCATCAAAGCTTTCTTAGCAGCAGCATCGGCCTTTTGCTTCTCTTTGAAG
GCAATGTCTTCAGGATCTAAGTCCTGTTGTTGCTTCTTCTTTTGCTTTAGAGGCTTCATC
TTACCACCTTGGCGACTAGACATGATTGCTTAGGGTTTTTCAGTTATTCTTCTGGTTTTG
CAACTTACTGTGCGTGGAAGAGCAATCAATTACAGGATTTTAAACATGAAATTTTTTATT
TTCCTCGTTCATTTTCGTCGCGGGAAACTTCCAGAAGTATAGATTTACTACAATTTTTAT
CTCAGGACAGAAAGAATAAACCAAAAAAGCCAAGACAAGCCAAGCCAAGCCGAGGCGACT
GGAGGAGCTTTTCATCACATTCAATGACAAATCACAACAGGTTTCCCTGTTAGAAAAGGC
ATGTGCACTCACAATTCATATTTTCATACAGAAGATATACATTGGATTTCTGGAGATATC
AGGTAAGGTTCGACAAAAACAATGGCGTTTGCCAACCCTTTATGATGGGTGATCTTGTAT
CCGCTTAATTGTGTGATCTAAAAAGGCAAAGTAACGTATTATTGGCTGGTTTATATAATT
TGAATATGACTACTTTTTCAACGTTAAAAACGATAAATACTTGCTCAAAGGGTTCAGCGG
CTAAATAAACTACGATTTCGCAGCAGGATCAGATGGATTCAATCACATCATTCGCAAAAC
ATTCACATCATTCGTGAAGCATTAAAGGTAATAAGAAAAATAGAACAAAGATTTTTTAAT
CAGTGAGGACCACAAAGGGACAGCAAATACGGTGATAAGA
Chromosomal Coordinates Chr XII from 670340-672823
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator