Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name LCB5
Systematic Name YLR260W
Description Minor sphingoid long-chain base kinase, paralog of Lcb4p responsible for few percent of the total activity, possibly involved in synthesis of long-chain base phosphates, which function as signaling molecules
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LCB5	6323289 upstream sequence, from -1000 to -1, size 1000
ACCCAAAGTAGCAGCAACCGCTTCAGCTAAAGTTTCGACACCCTTAAGAAGGGAGGCTCT
TCCTTCTACACCGAATTTCAATTCTTTATGAGAGGAGTAAGCACGACGCAATAAAGGCCT
TAAAGTAGCGCGACTACGAACAACGGATGATCTCAACATTTTGAAAACTTTTTTGCTTAT
GATGTTTTCTCGTGGGAATTTTCTTATATTATTCAAGGAAGTGCATGAAGACGCAACCAC
GACCTTACATAATGAATGTAAAACTTAGTCTCCTTCAATATATATACATGAATGTCCGTC
TGGATTCTGCTCCGGGCAAAACGAAGCAAAATTAAAGTCACCCTCCCCATTTGGTTTTCT
GGAAAATTCCACGAGGTCCGTATATGATGACATATACAGATGGGCGGCTATAAAGTAAGT
TTCCAGAGGTAATACCAGGCAATAAACAGCTTCAATTGCTCGTAACACCATTGTATACCT
ACAAAAACAGTGGAATAGGGATGAGACATAACTGGCTGGAATTTCAACTGTACTTCTTTG
CACAACTAGTCTTGGCGTTCTACTTGATCATTGCGCGAATGGATGCACTCGCAATAATTC
CCAATAGTATAACAGGAGGAACATTTGGATGCATTAGGTATATTATTCATCTTCTTTATC
ATCAAAATTTTCTCTTCCTTTATGTTACTATGTTGCTTTCTTTTAATCTATGTTTTTTTC
CCTTTCAGTTGCCACCGCTTTTCTGCAAGATTCATAGTTAGATTTGCAAATCAAGGTGTT
TTCGGGCCTTGTTAAAGCCTTCGCAGGCGAAGAAGAAAGGGAACGTAAGCTGCGTGAGCC
GAATCTATTTATACAAAAACAATCAAAAAAGTATAACTACAGCATAAACTGTTGTATATA
CGTGTTGCAAAATAGGAAAGAAAAGAAGAGTAAAAGGACTCTTGATATTATCTCGAAAAA
ACCACAAATAGTGTAAGATTTAAACAGTAAGCCAAAAGAG
Chromosomal Coordinates Chr XII from 665844-667907
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator