Yeastract IST INESC-ID IBB-BSRG
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YEF3
Systematic Name YLR249W
Alias eEF3, EF-3, TEF3
Description Gamma subunit of translational elongation factor eEF1B, stimulates the binding of aminoacyl-tRNA (AA-tRNA) to ribosomes by releasing eEF1A (Tef1p/Tef2p) from the ribosomal complex; contains two ABC cassettes; binds and hydrolyzes ATP
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YEF3	6323278 upstream sequence, from -1000 to -1, size 1000
TATTTCAAAGAGACTCCTCGCTACTGTTTTCACCAGCTGCTGTTGCTATGCGTGACGCCT
TTGATATTGGTAATGCTGTGAAACGTACCGAAGAAGACCGTATGGGAACACGTGGAGGAT
TAGGCTCGCTTGCTGAGGACGAAGAATTGGAAGATAGTTACAGTGGCGCCCAAGGCGATG
AACAGCTGGAACAAAATATGTTCCAATTAACGCTGGATACGTCCACGATTCTGCAAAGAA
GAAAAAAAGTTCAAGAAAATGACGTAGGGCCTACAATTCCAATAAGCGCCACTATCAGGG
AATAGCAACTTTCCCTTCTGTTTCAATCTTTTTACCTATTCCTTTTTAAAAGATATATAT
ACATTAAACTCCTTCTACAAGTATATATTTTATACATATCTACAGGGCGTATATATACAT
AACATTTTAAGATAAGCAAGTGAATGTTGATTCCCGTTTCTTAGTCAACACTTCTTTCTA
TTTTACCCGGTCGTTACCCTATTAAAAAAACAACTTACAATCATTGTTCGCCCCTTCCAT
ACTTACTGCCACTCGCAAAAGGGCCCAACCAGGGCAATTACGTATCAAAAAATCATGACA
GGCTGGGTAATAAATATTCGTGAAGAAAGAAGAAATTAAAAAAAGAAACGAAGAAGCAAA
AAAAAGAAAAGACTCCGTTTAATCACTTTCAACCGCGGTTTATCCGGCCCCACCCATGCA
TAACCCTAAATTATTAGATCACTTAGCACGTGAAAAAGAAACGTTTTTAATGTTTTTTTT
TTTTTTTTCTTTTTCTTTTTTTGCGTTGGTGAAAATTTTTTCGCTTCCTCGAGTATAATT
ATCTCATCTCATCTTTCATATAAGATAAGAAGTTTTATAAAAACCTTTTGCATCAAAATT
TTGTAGAATATCTCTTTTTCTTACGCTCTCTTTCTTTCCTTAATTGTTTTCTAAAGAACC
GTGTATTTTTCTAGTTCGAATCCATCGATAACATTAAAAG
Chromosomal Coordinates Chr XII from 636780-639914
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator