Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YEF3
Systematic Name YLR249W
Alias TEF3
Description Gamma subunit of translational elongation factor eEF1B, stimulates the binding of aminoacyl-tRNA (AA-tRNA) to ribosomes by releasing eEF1A (Tef1p/Tef2p) from the ribosomal complex; contains two ABC cassettes; binds and hydrolyzes ATP
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YEF3	6323278 upstream sequence, from -1000 to -1, size 1000
TATTTCAAAGAGACTCCTCGCTACTGTTTTCACCAGCTGCTGTTGCTATGCGTGACGCCT
TTGATATTGGTAATGCTGTGAAACGTACCGAAGAAGACCGTATGGGAACACGTGGAGGAT
TAGGCTCGCTTGCTGAGGACGAAGAATTGGAAGATAGTTACAGTGGCGCCCAAGGCGATG
AACAGCTGGAACAAAATATGTTCCAATTAACGCTGGATACGTCCACGATTCTGCAAAGAA
GAAAAAAAGTTCAAGAAAATGACGTAGGGCCTACAATTCCAATAAGCGCCACTATCAGGG
AATAGCAACTTTCCCTTCTGTTTCAATCTTTTTACCTATTCCTTTTTAAAAGATATATAT
ACATTAAACTCCTTCTACAAGTATATATTTTATACATATCTACAGGGCGTATATATACAT
AACATTTTAAGATAAGCAAGTGAATGTTGATTCCCGTTTCTTAGTCAACACTTCTTTCTA
TTTTACCCGGTCGTTACCCTATTAAAAAAACAACTTACAATCATTGTTCGCCCCTTCCAT
ACTTACTGCCACTCGCAAAAGGGCCCAACCAGGGCAATTACGTATCAAAAAATCATGACA
GGCTGGGTAATAAATATTCGTGAAGAAAGAAGAAATTAAAAAAAGAAACGAAGAAGCAAA
AAAAAGAAAAGACTCCGTTTAATCACTTTCAACCGCGGTTTATCCGGCCCCACCCATGCA
TAACCCTAAATTATTAGATCACTTAGCACGTGAAAAAGAAACGTTTTTAATGTTTTTTTT
TTTTTTTTCTTTTTCTTTTTTTGCGTTGGTGAAAATTTTTTCGCTTCCTCGAGTATAATT
ATCTCATCTCATCTTTCATATAAGATAAGAAGTTTTATAAAAACCTTTTGCATCAAAATT
TTGTAGAATATCTCTTTTTCTTACGCTCTCTTTCTTTCCTTAATTGTTTTCTAAAGAACC
GTGTATTTTTCTAGTTCGAATCCATCGATAACATTAAAAG
Chromosomal Coordinates Chr XII from 636780-639914
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator