Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEC13
Systematic Name YLR208W
Alias ANU3
Description Component of the Nup84 nuclear pore sub-complex, the Sec13p-Sec31p complex of the COPII vesicle coat, and the SEA (Seh1-associated) complex; required for vesicle formation in ER to Golgi transport and nuclear pore complex organization; the Nup84 subcomplex has a role in transcription elongation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC13	6323237 upstream sequence, from -1000 to -1, size 1000
AAGAGCGTTTAAACAGGGAAATATAGATGCTGGTGTTGTCGCGGGAGATATCTATTTTCA
GATGCAGAATTACAGTAAAGCTATGGCTCTTTATCAGGGTGCAGCTTTGAAGTACTCTAT
ACAGGCTATCTGGAACTTAGGGTACATGCATGAGCATGGGCTAGGTGTAAACAGAGATTT
CCATCTTGCTAAACGTTACTACGACCAAGTTTCAGAACACGATCATAGATTTTACTTGGC
TTCCAAATTGAGTGTTTTAAAATTACACCTAAAGTCATGGTTGACTTGGATCACCAGAGA
AAAAGTAAACTACTGGAAACCTTCCTCGCCACTTAACCCTAACGAAGATACTCAGCACTC
GAAGACTTCATGGTACAAGCAATTGACGAAGATTCTACAAAGAATGAGACATAAGGAGGA
TAGTGACAAAGCTGCGGAAGATTCTCACAAACACAGAACTGTAGTGCAGAATGGAGCTAA
CCATAGGGGTGACGACCAAGAGGAGGCTTCCGAGATTTTGGGCTTCCAAATGGAGGATCT
TGTTACGATGGGATGTATCTTGGGGATATTCCTATTAAGTATATTAATGAGTACACTGGC
GGCCCGTAGAGGCTGGAATGTCCGTTTCAATGGAGCACAATTAAATGCAAATGGTAACCG
GCAGCAAGAGCAACAACAACAACAACAAGCACAAGGTCCCCCGGGCTGGGACTTCAATGT
TCAGATATTCGCCATATGATGTGGTTTGTATAGATATATACATAGACTATCCATAGAAAT
CACCCACGCATTACCCGAAAGTTTTCAATAAAGCGAACAGCGAGAAGAAAAAAAGCGAAA
CCGACAGAGAATTACCACCCTAGAGCTTTAACCCCATTGAGATCAACACAATTTCGAACA
GTGAAAGTGCATTGGCGAAGGTGATACAATTGGCTTCCAGCTCTGAATAATAATAACTTA
CAAGCGCAAAGATAACAGATAATTTTATATCAGCATACAA
Chromosomal Coordinates Chr XII from 559551-560444
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator