Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEX13
Systematic Name YLR191W
Alias PAS20
Description Integral peroxisomal membrane protein required for translocation of peroxisomal matrix proteins, interacts with the PTS1 signal recognition factor Pex5p and the PTS2 signal recognition factor Pex7p, forms a complex with Pex14p and Pex17p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX13	6323220 upstream sequence, from -1000 to -1, size 1000
GGCTCAAAGATCCCAAAGAGATATTGAGAGAAAAGTCAAGCAACTGGAGAAAAAATTCTT
CAATTGTAAAAAAGTTCTTAAGAAATTGACTGAATCCTCCGCAGTAGTGGCCACCTCCAC
TTCAAAAACTGAAGGAAATTCAGCAAGAATCCCATGCCCTAAGACTAGACTGGCACGCGT
TTCTGTTTTAGACCTAAAGAAAATTGAAGAACAGCCAGATTCTTCTTCGGGAACTTCGTC
CGAGGAAGATCATCTAACAAACGATGATACGGATGCTAATACTAGCGAAGATTTAAATGT
TGCTTTTGAAGAGGAGCCAACTTCTGCTATTTCCACAACAGCATCTGTGCAGAGTGGGGA
AAGTAAAAGAGGTTTCCAACTTAACCTTCCTGTCCAAGTGGAGAAGAAGGAAAAATGAAG
CGTCAACTTCAAATTAAATTAACTTATTTTACACAAACATTCACAATACATCAATGCTGA
TAGGCGCTTTGTATTGTAGGCTATCGAGTTACGCATCTGCAATGTGCGTGATTTCTCCGT
TATCCATCCTTCTCATTGGACAATTTTTATTTGAATATTACTGAACTTCAAAGGGCTTGT
CGTGTGATTTAATCTTTTTTCTTACAACGTCGAATGCTGCAGCTATTTATTCATAGTGTC
GTCTAAGCAAATACCCCGCTTTTAAAAGCTGAATAGAAAATCCAATCACGGTGTGACTGG
TATCACAAACACATAATTTATATATTGCATTCAAGTTTATTCAACCTATACTTAAATACA
TTAATTACCAAAAAAAATGATATAATAAAGTCTTCTTTTATCTGATTAATGACACCTTTT
TCAGCGGGCCAAATTTTTTTTATTTCCGAAGCCCGCCGGACTAATATTAATTATATCAGA
TAGTTGGTGAGCAAACGCATGTGGAAATGAACAACAATTTCGAAAGTGCATATACTATCT
ATAAATATCAAGGGGATTCTATACTATAACAATACCTGCG
Chromosomal Coordinates Chr XII from 537272-538432
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator