Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name EMG1
Systematic Name YLR186W
Alias NEP1
Description Member of the alpha/beta knot fold methyltransferase superfamily; required for maturation of 18S rRNA and for 40S ribosome production; interacts with RNA and with S-adenosylmethionine; associates with spindle/microtubules; forms homodimers
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EMG1	6323215 upstream sequence, from -1000 to -1, size 1000
CTAAAGCCTCATACAAATAATATAGACAAAAATGGGTAGTATGTAGTAGGACATTGAGAA
TAAAACTGTGAACCTGTTATTGACGACCGTGGAGAAATGTTATGATTATCTGAAGAGAAA
TATCGGAACGCATGCACACCAAATTTATACTTAGCAAGACTGGACGATACGAGACTGGTA
TACTTGTATGAAGACAGAATAGTGAACGAAAGACATGCGCATGACAACAAATTTACCGTA
TAGAAGAAATATTCTGCTTGTATGCCTGAGGGAACTCGAAAGGATCAATTTCAATGGCGT
TGTAACAGTCACGAAAAAAGTGTAACTATAAGATAAAGCAAATTGTACTAACAAACTTAA
CCAAATTGCACAACAATTTGATTTTCTTTTTAAATAGAGGGTACTCCTTCATTCGGTAAA
CGTCACAACAAGTCCCACACTTTGTGTAACAGATGTGGTCGTCGTTCTTTCCATGTTCAA
AAGAAGACCTGTTCCTCCTGTGGTTATCCAGCTGCTAAGACCAGATCTTACAACTGGGGT
GCCAAGGCTAAGAGAAGACACACTACTGGTACTGGTAGAATGAGATACTTGAAACACGTT
TCAAGAAGATTCAAGAACGGTTTCCAAACCGGCTCTGCTTCTAAGGCTTCTGCTTAATTT
TTATACTAAGATCTATTTCTTTAAATGAAAACTCAATAATTAGAGACCTTATATAATAAC
CAACTGCAAAAAAACTTCTAAACAATTAGTTAACAAATCTCCAGCCTTTTTTTAATATAT
CTTTATTCATATGTAACGCCTTTGAGTGCTTACGGGAAAAGTAGAATTGATAGTTTCGTA
ATTCATGACCGGAAAAAGTGAAAAATTATTGTTCGATGAATATATACAGAGATGTCTTGA
ACTGTTTTTGCCAGCATCATTCGTTATAGGGAGCAAAGTTAGTGCAACCCAGTTACCAGA
TATCTAGTCACCAAGAAGAAAACCCGTAAAATCGTAGGTC
Chromosomal Coordinates Chr XII from 523632-524390
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator