Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CLF1
Systematic Name YLR117C
Alias NTC77, SYF3
Description Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; homolog of Drosophila crooked neck protein; interacts with U1 snRNP proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CLF1	6323146 upstream sequence, from -1000 to -1, size 1000
TATTTCCTTCTTTTCAGAACGCCTATTCTAGGGAAAAATGGCTTCTGTATGAAATAAAAA
TGTTAGCAAAAGAGAACGAAAATAAGAACACATACACTATATTTGCCCATTTGAGCGCTA
TCGAATATGAATGGACTTAGAGTTGCAGCAAAAATTCAGCCAGCACGCCAAACTATCATA
TTCTTGCATGGATTAGGTGATACAGGTTCGGGATGGGGATTTTTAGCTCAGTATTTACAA
CAGAGAGACCCTGCCGCTTTCCAGCATACTAATTTTGTTTTTCCTAATGCTCCAGAGCTT
CATGTGACAGCAAACGGCGGTGCATTGATGCCTGCTTGGTTTGACATCTTGGAATGGGAT
CCTAGTTTTTCCAAAGTTGACAGTGACGGTTTTATGAATTCTTTGAATTCCATAGAAAAG
ACGGTTAAGCAAGAAATTGATAAAGGAATTAAACCGGAGCAGATTATTATCGGAGGTTTC
TCTCAGGGTGCCGCATTAGCTCTCGCAACATCAGTTACTTTACCATGGAAAATCGGTGGT
ATAGTAGCTCTGTCGGGATTTTGTTCCATCCCAGGAATTCTGAAACAACATAAGAATGGC
ATTAATGTAAAGACACCAATTTTTCATGGGCATGGTGACATGGATCCAGTAGTTCCTATT
GGACTAGGTATAAAGGCAAAACAGTTCTATCAAGATAGCTGTGAGATACAAAATTATGAA
TTTAAAGTATACAAAGGTATGGCCCATTCTACAGTTCCAGATGAATTAGAAGACTTGGCT
TCATTTATCAAGAAGAGCTTATCATCATAGCTCTTTTCCTAATATTGCGAGTTCAATTTA
ACCGCTATTATACTTGGTTAAATAATTTATATACATCCGTAAGACGCGATAGAAAATTAA
AAACCTTGGTGCCAAATAGTTGGGGTGATGAGACTCATTGATTATGCAAGTTCATAATAG
ATAGACAAACTTGAGCTAAAAGTACTCTACTATTGCCAGC
Chromosomal Coordinates Chr XII from 384534-382471
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator