Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL10
Systematic Name YLR075W
Alias GRC5, QSR1
Description Protein component of the large (60S) ribosomal subunit, responsible for joining the 40S and 60S subunits; regulates translation initiation; has similarity to rat L10 ribosomal protein and to members of the QM gene family
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL10	6323104 upstream sequence, from -1000 to -1, size 1000
TATTTTTGGTTCTGATCTTTACTTTACTGTTAAGTACTGGCTGAGGCAGTAGACTCTGCC
TCTGTTACGGCAGCGGTATTCGCCTCGGCATCAGCAGCCGCCCACGGTAGAGTAGGTTCT
GTTGTTTTGACGTTTGCCAAGGTACTGTCCAAATGCTCCTTCAGCAAGGCCTCATTACTT
TCCTTCTCCGGACCCACCGATTGCGTGATCTCCTGTACACGGTTCAAGAACTTGTTCAAA
TTGTAGCCCGCAGCAGCATCAGAGACTTCTTGTGTGTAAGGGACACCCCTCAACTCCTTG
ACTCTTCTTTTGTGCACTTTGCCCTTTAAATGCGTTTTTAACGCTATAGCAGTCTCCATG
TATTTGGCACAGTGTATGCAATAGTGCTGACCAAGGCCCGGTTTGGTTTCATCCAATGGC
TGGTTCAGAAGCTTCTGTACTGATTCCTTGGTGGACAAATCGTTATAGATCAGGTCCAAG
TCTCGTGTTCTTCTTTTAGTCTTGTATCTCTTCACCGAATATCTACCCATGATGCGCTAT
TGTTTTATCTTCACTTGTCTGTGTGTTTAACTGCCTTTCAATTCACCTCATCTCATCTCC
CGCTACTTTCCATATATAAAAGCAAAATTAATTTGCTTTTTCCCCTGTCAGTATAAAAAA
ATTTTCCGCAGGATATAGAAAAAAAAGAAATGAAATTATAGTAGCGGTTATTTCCGTGGG
GTGCTTTTTTACACCTGTACATCTTTTCCCTCCGTACATTTTTTTTATTTTTTTTTTTGG
TTTTTTTTTTTCGATATTTTTCCCTCCGAAACTAGTTAGCACAATAATGCTGACTAAGGA
AACTTTTCATCTCAGAATTGATGGTCAGTTTGGTTTCTCTAGAGAATAGTTTATAAAAAG
ATGTTGATGTGGAGCAACCATTTATACATCCTTTCCGCAAGTGCTTTTGGAGTGGGACTT
TCAAACTTTAAAGTACAGTATATCAAATAACTAATTCAAG
Chromosomal Coordinates Chr XII from 282927-283592
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator