Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SHM2
Systematic Name YLR058C
Alias SHMT2
Description Cytosolic serine hydroxymethyltransferase, converts serine to glycine plus 5,10 methylenetetrahydrofolate; major isoform involved in generating precursors for purine, pyrimidine, amino acid, and lipid biosynthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SHM2	6323087 upstream sequence, from -1000 to -1, size 1000
CAAGCTGTTCAAACCCTTGGTCTGGATCGACTGCGAGATGACCGGTTTAGACCACGTGAA
TGACAGAATTATCGAGATTTGCTGCATCATCACCGATGGACACCTGGCACCCGTCAAAGC
GGCCGATGGCCAAGGAGACTCGCATTATGAGAGCGTCATCCATTATGGTCCCGAGGTGAT
GAACAAAATGAACGAGTGGTGTATTGAGCACCACGGTAATAGCGGTCTCACCGCCAAAGT
TTTGGCAAGTGAGAAGACTTTGGCCCAGGTAGAAGATGAGCTGCTCGAGTACATCCAGCG
CTACATCCCAGACAAGAACGTTGGCGTCTTGGCAGGCAATAGTGTACATATGGACCGCTT
GTTCATGGTCCGCGAGTTTCCCAAGGTCATTGATCATCTCTTTTACAGAATAGTTGACGT
CAGTAGCATCATGGAAGTTGCCCGCAGACACAATCCCGCTTTACAAGCACGTAATCCAAA
AAAAGAAGCTGCCCACACTGCTTATAGTGATATCAAAGAGAGCATAGCTCAATTGCAATG
GTACATGGACAACTACTTGAAGCCACCACAGGAAACAGAGTCGGTCGAGTCAATCGGATC
TGAACAGCCGGAGTCACCATCTTCATCTACCTCATCTTTGAAAAGACAACGCACCGATTT
TTAATGTAGAAAAAAAAAAAGAAAAAAGAAGTGAAATTTTTCAAATATTTCACACACGAA
ACATGACTCCTGGTGAGAAATGACCCTTTCAGGTTGCTTTGACCATAAAGGTTTGACTCT
ATCTCTTGGGTTTCTCATGTTCGCTTTTTACTCTGTATAATTTTTAAATTCATAATCATC
TTAGACCGAACCATGAGTCTTCTTCATCTTGTTTTATATATAATGCAGAACTTGCTTCCC
TTAGTTTGCGTTCAGTAATCTTTCCTTCTTCTAGTGTAACCTTTACGAAAGATACTACCC
CATAGCAAAGCATAACAGCTTAAACCGAATCCTCCTTAAC
Chromosomal Coordinates Chr XII from 259401-257992
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator