Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name KNS1
Systematic Name YLL019C
Alias L124
Description Nonessential putative protein kinase of unknown cellular role; member of the LAMMER family of protein kinases, which are serine/threonine kinases also capable of phosphorylating tyrosine residues
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KNS1	6323009 upstream sequence, from -1000 to -1, size 1000
ACCACGACGGCGAATGCACCAAGTACATGCAAGAGTATCTCAAATGTATGCAGCTTGTGC
AGAACGAAAATGCAATGAATTGTAGACTACTGGCAAAGGACTACCTGCGGTGCAGGATGG
ACCACCAATTGATGGACTACGATGAATGGTCACATTTAGGTCTTCCTGAGGATGCTCCAG
GCAACAACGGTAAAACCATAAAAGACGCCACCGATAATAAATAGCCGCCCACATCGGAAT
ATCGAATAAAAGCTAGACGCTGTTGGTAATATCATACTTTCTACAACAACTGGTAAAGAA
CTTCTTTTTTTGAAATAGCCGCCGATATGGCGCGAAGTGACCCTGCTCGAGGCTGTGCGG
GCCCAGGCCCGTCCGTTTCTTTTTTTTCTAGGGGGCGGCAAACGGGCCAAAGGGGTCAGC
GTGATTGGGCGGTTTTCCACAAAGCTTTAGTCTCTCTCCTCACGCCTTGGCTTAGTGAGT
GGCCGGAGTTAAAGTTGCGAGGAAACACACAGCGAAGGGAAAAAGCTTTGGCGTGCTTAA
CGATATGGCTTATGGCCCGGTTGCAATGCTGGTTTAGTTTCCGATTACGATTTTCGATTT
GAATCCTGGCTCCACATCTCCCACCCTCTTTTTTTATCTCTAGCATCGTGCGTTGGATTT
TATATTATGAAGTTCCTATATTAGAATAAAGTTTAGTATTTACTTCCCAGATCTACCGGA
TTTACAAAGTATTGTTACCTCACCACCAAGTGAAAGGAAACAGTGCAGTAACTCCTCGTG
CTTACGCTAACTAAATAGATATTATATTCACGAAATACTGCGCCAGATAGCAAGCAAACC
CAAAAAAAAAAAAGAAAAAGAAAAAGGAAACAAAGTGGGAGACAGAAAAAGAGTGAAAGA
AACATAGTATTTACCAAGTCGAAGATTTAGCACAACAAAGACTAATCTACACGCATACTG
CTCTTCTTCATTATTGCTTTATCTTCCGCGTACCTTAGTT
Chromosomal Coordinates Chr XII from 107899-105686
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator