Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SOF1
Systematic Name YLL011W
Description Essential protein required for biogenesis of 40S (small) ribosomal subunit; has similarity to the beta subunit of trimeric G-proteins and the splicing factor Prp4p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOF1	6323018 upstream sequence, from -1000 to -1, size 1000
GTTTTTCCCTCCCGGTTCGGGATCTAAAGAATCTTTTTTCACTTCTAAGATCGCAAACTA
TATTGCCTTGGCCCCCGCAGTGTATCCTGGTCCCTTACTTAACGAGAAATTGTTTGTTAA
GCTTATGACAAAGGAAATCGAAAATCCCTGGTTCTTTGGTGAAACGAGCTTTTTTGAGAT
AATGATGATTGTAAGAAACTTGTGCGTTGGTGAGAGCTTGTTCTCCTTTGTTTGTTACAC
CATCTTCAATTACCTGTTTGATTGGAACGATACCCTTTGGGATACCGCATTAAGAGATCG
CCATTTCCTGTTTTCGCCAGTCCATGTTTCAGTGAAGTTGATGCAATGGTGGCTGTCACC
CGACCCCAACAAGGTAAGTTTTAAATTTGGTTCCCATAAGATGTTCCCCGACAATGTTAA
GTGGTTTTCAGACGCATCAAAGGCCCCAAATATCTACTTGTTTGTTCCAAAGCAAGATAG
ATTGGTGGACGGAGAAAGACTAATCAATCATTTCGTCAATGTGGAGTCGAATGTCAACTA
CAAGATCTGGTACATTGATGAGTATGCCCATATTGATGTCCTATGGGCACATGATGTCAT
AGAGAGAATTGGTAAACCAATTTTACAGAATTTGAACAACTATTACTCCAAGAAGCCATC
CAGCGCCTTTGAAAGTGATTGTTCGGACACAGAGGTGGAAACGGAGCTGGAAATGGTTGC
TGAGAAGGCTTGAAGAGGAAGCATGATATATAGGTTAATATAAATTATACTTGGGAATAC
ATAGATAGAGGGCTAGTAAATTTTTAGTTTTTAATTGTTCTTTTTTTTTGAAGTATTGTG
TCACAAATTGTCGGGAGTTGGGACATCACCGTGCATAACGATACATTTTTTTGAAAAATT
TGATATTGAAAAAAAATCGATGAGTTTGAATTACATTACAGTTGTATAAAGCAACCGCAT
TTCATTAACGTAGTTTGACTCGCGAAGATAAGGCGTTAAA
Chromosomal Coordinates Chr XII from 127523-128992
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator