Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SIR1
Systematic Name YKR101W
Description Protein involved in repression of transcription at the silent mating-type loci HML and HMR; recruitment to silent chromatin requires interactions with Orc1p and with Sir4p, through a common Sir1p domain; binds to centromeric chromatin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIR1	6322954 upstream sequence, from -1000 to -1, size 1000
TCTCTTTGTTATATGCCGTTGGGAAGATGATAAGGAAACATTGGAGCTGTTATTTATACT
TGGTAAATCCACAACGGACTTCTGCCTGGCATTATTGCCGTAGTTATTATTTCGTACTTG
AAGTAAATTTATTTTCCTACGGTATGCTGGCACATAGTATTTACTATTCTTTTTCCCTAA
CGGTTTCTCTTGATCTCGCGATTTTCCATCTTTTTCTTCTGGATGAGCAGATCCTTCCGA
TGAACCAGAAGTGTGATCAGGATTTTTTAGCTCGGAGCTGGCTAGTGCTGCTTCATCTTT
ACTGTCTCTTAAGGGTCCAAAATTGTCAAAGGACACGAAACCACTTTCATCATAAATAGC
CCTTTCCAATTCTCTATCGTCTTGTTCCTCCCTCTTGTATCTTTTTTGTAGGTTAAACCA
GAAACATACTGCTATTATAATACCTACACCGACGGGTATACCCACCGCACAACCCACCGC
AACTGATGTGCTGGCAGTCATCTCTTTTACTTCTTACTACGATGAGCTCCCAAAAAAAAA
ATATATCCCTGATAAATAACACAAAACTAAGAAGCCGGACCTAGGTGAAGAGTAAAATAA
GGACTCGAAATTTTGTCTAATACTCAATAACTCAGTACAAAAACTGCCTCACAGTATAAA
ATATCCAACTTAGAGATATTCGTTTTAATTGTCCCGAGCAGGCAAACGATAACTGATCCT
TAGTCACAATAATAAGTCTATGCTTTCTGTTGAAAAAGAACAAATAGCGAGCGAGTCAGC
AAGCAGAATCTAAAGAGGCTTGCAACGAATGGTAGGCAAAGAATTTCTAACCCGAAACCT
CAAGCGAATGGTGGATTCCTTACTTCCAATCTTCTAAAAGTCTTTAACTCTGATTTCGAG
GATCAGTACTTTTTCTATGGTTTATTAATATCGGCCTCGAAAAGTTTGTCGCGAGAATTT
GGGCACATGTGACCCGGAATGTATATTGAGTAATATAAGA
Chromosomal Coordinates Chr XI from 640540-642504
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator