Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MET1
Systematic Name YKR069W
Alias MET20
Description S-adenosyl-L-methionine uroporphyrinogen III transmethylase, involved in the biosynthesis of siroheme, a prosthetic group used by sulfite reductase; required for sulfate assimilation and methionine biosynthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET1	6322922 upstream sequence, from -1000 to -1, size 1000
TTAAAAATATTTTGAATGCACACTTACTTAGTACTTCGCTTGTCTTCACTAAATTCTCAC
AGCGTGGCAATGCCGTTCTAGCCAAGAAATCCTCAATAAGTCTACACCCAATATTATATC
CCATGCTATACAAATGATCATTCACTTTGTTAAAGTCCCGTTCATAATCTTGGCACAATT
GTGCCACTATGGACCCATATGTTAGCGTAAATAATTCTGTATTAATTTTTTCTGTTTTAT
TTTTCCAGATCTCTTCTCCCATGGCCTTCAAAGACCTCGATTGCGTGGTAGAAACCATTT
TTGACCCAGTTTTGGTTATCAATGAACACTTGAAGCTTTACTCTGCATTCCCATCTCTAT
AGCTATGGGTAATCACAGCTACGATCACTTACTCTGTTATTATTATATTAAGTTCAATGT
TGGCCAAACCGGGTAACATGTAACACTTTCAGGTTGGCCTTACCTTTGGCTTGGAGTTTC
GCAAGTTTTCAAATTTTTGGCTCCTGCTGTCAAGGTGCATAGAATAGCGCTTATTTATCT
ATTTATATCCAAGATGTACAATCCTCGTTCTCTGAGTCCAACATATTTGCTCGCAACTGT
AGAAATCACAACTACAGCAACAGTAAAGATATCATTTTCTATTTTCGTTATTGGTTTCTC
GACCTTTTTATATACGATACGTCAAACTTGAATCATTTTATACGTTTTTCTCTTTCTAGA
AATGCCATTATGCACGTGACATTACAAATTGTGGTGAAAAAAGGCTCTCATAATAAACTG
TGAACGGACTCATAATGAAATTTGCTTCACTATGTGAATCATCGCTAATAAACTCGCTAC
AAAAGTCGAGTATGCTTAAGTCAAAAAAATGATATATATATATAATTTACTTATGTGTTT
CTGCAAAGTTGTAGGCTTCATTTAGAATTGCTCAGATATTCCATCCCAATTAAAAAAAGC
ACGGATAGAGTGATAAATAAACTAAGAAAATTTCAAAAGA
Chromosomal Coordinates Chr XI from 571612-573393
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator