Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLG1
Systematic Name YKR058W
Description Self-glucosylating initiator of glycogen synthesis, also glucosylates n-dodecyl-beta-D-maltoside; similar to mammalian glycogenin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLG1	6322911 upstream sequence, from -1000 to -1, size 1000
ATTCTTTGAACCGTTTGGCTCAAAACGATGGTTTGTTAAAGAACGTCTGGTCTTACTCAC
GTTAAGAGAAAAGAAAAAGAGGATTCGATTTAAGCTTCATATCGTTCAGACTAATAGGTA
ACTGACGATTTTTCTCTTCATTACCAACTTTTCACCATATGTTCTAATTCGTCGGATTTT
CGATGAAGCGTTTTAGGTACTCTATAGGTATTTAGGTTATAATAATATATTGTATTTTTA
GACAACCGGAACCTGTTTAATTTGAAGAGTCATTGTATTCTTGGCTATTCTGTTTAAAGT
TTTGCAGTGTGGAGTCCCTGAGAAACCCCCGAGCAAAAAAAAGACCCCAAAACCCCGTAA
ATATTACTACTCTACTTGTGTGTTATACATTTTCAGGAGTCAAAACGTACTAACAACCTT
AAGCTTGCTTAAAGAGGTGCTATATATGTCGATAAGAAGCAGAGTATAAGGGTGCCTGAA
AATGTTTGTTGCTTGTAAGCTATGCCTTTACTCTTGACTTACTTCAATATTGTTGGCAAT
TCGTGGTGGAGACTTAGTAGGGATTCTATTTTCGCGTACTAGTGTGATGGGAATGTATAA
GAAGCTGCTATTGCCACATTGCTCTATTCCGCAGATTATTTACCAGGTGTGTTTGCCCTT
GGTCACCAAGTGAATAAATTGTTAGAGGAAGCAGGCAAAAAAAGGCGACATTGAAACATG
CCTTATTGTGACGACCTCTCTATTTAATGGCACTTTAAGCGAGCTAGCCAAGAATATTTT
ACAATCAATATACACCAAAATTGTGTTGGTAGAGCCTTTAAATTGCCAAGAAGAAAGCAT
ACAGAAGAATAGTGAGAATTTAGCTCTTTTGGAAAGACCTGAATTATCCTTTGCCTTAAT
CAAAGCAAGACTATGGGAATTAACTCAGTTCGAACAAGTTCTTTACTTGGATTCCGACAC
TTTACCTCTGAATAAAGAATTTTTAAAGTTGTTTGACATT
Chromosomal Coordinates Chr XI from 552770-554620
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator