Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RHO4
Systematic Name YKR055W
Description Non-essential small GTPase of the Rho/Rac subfamily of Ras-like proteins, likely to be involved in the establishment of cell polarity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RHO4	6322908 upstream sequence, from -1000 to -1, size 1000
AATGTTTGTTTAAGAACCAAAAACCATTTGTTTGCAATGCTTTGTAAAATGTTCAAAAAT
CTCATACTTTCCAAATCATTACTAGGAAGGTAGTTTGCATAATCATGTGAAGTAGCCCCT
TTTGATACAGCCAATTTGATAATGCTAGGGACCATCGCTAAAAGATCTGGCGTTTCAATT
GAGGTATGTAACTGTTGAAATTGTTTAGAAATGTCGTCAAGTTTCCTCCTCGTTTTATCT
ATAGTTTCGACAGAATATGTCTTTGTATCTGATTTTATCAATTGGCCAAACACAGACGAT
ACGCCATGTGTGATAATTGAGGCCAGGTTCCCCGCATTTACTGGACCAGGTAAGTATATG
GCACTTATTTGTGTTGCAATCGGTTCTGCATCCACAATAACACTTCTAGATTTAATAATT
AATAGAGTAGAATACTTTTTATTCGCCAAGTTGGCATCATATATAGCCTCTTCACCAATG
TCTATTGTAACTATTGTTCTATCCAGCTCTTCAAAAAGGAAGACAAACAACGTGTCGAAC
TCTCTCCCATCCAATAATCCCAAAAAAAATTGAAACCGTTCAAGGTATTGACAATGTAGA
TAATCAATGAATGCTTGCTCATTCTCTTTGGGAGAATTCTTTATACCCGTTACAGTAGCT
GCAACAAATTCTATCAGCTCATTAGCAAGTCTTGCCTCATTCTTGCACATTGCCTAAAAA
ACGTTTTGACGTACTTTCCAATTTAAGCTCTGAACGAGTATTATTGCCCTTCTATGTTCT
ATGCTTTCTGTTAATTTTTATATGTAATGTTTGTTTACCTTTCATTAGCTTATTTATTAG
AATCCGTACAATGCGACCTTCCGCGCATCAATTCGGGATGATCTGATTAAGTAGTTATAG
CCTTACGTTAAGACGACAAAAGACATGATAAGCATCCCTCAAAAGTTACAGCAAACTTAA
GTCAAATAGGTCCAAAAATCTCCAATAGTAACGCTTTTTC
Chromosomal Coordinates Chr XI from 548216-549091
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator