Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DAL80
Systematic Name YKR034W
Alias UGA43
Description Negative regulator of genes in multiple nitrogen degradation pathways; expression is regulated by nitrogen levels and by Gln3p; member of the GATA-binding family, forms homodimers and heterodimers with Deh1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL80	6322885 upstream sequence, from -1000 to -1, size 1000
TTTCTTAAAAGCGTGGCCAAACTCTTTCTTCCAGCCATTGAACTGCTGTTGGGTGTAAGC
TACAGAAGAAGAACGCCTTTGAGGGGCTCTTTCTTCCTCTCTTTTAGAATTCCGCTTAGA
ATGAACATTATTGTTACTGCTATGGAGATTGTTGTAGAGCCGGTGCATATTTTCCTCATC
AGAACCTCGACGAGGATCATGTTCATTAGAGTGCATAATATGGTCTAATGAGTGGTTCGG
TGACACATCACTCAGGTTTCTATCTACAAAGGATTTGGGCAATGCATGCTTCCTCTCCGC
CTCCTTGCCGTTGGGAGTTCTTCGTTTTTCTCTTTGTAAACTGCTAGTCAGATTGCCATT
CTCAGGTAATTGCCGCAATACTTCTTGGTTTTCTAACTCATCTGGTCTCGAATTTACTCT
ATCTACTTCTTCAGTCACCGATCTATCTGCCTGAGGTGGAGCGAAGTGAGTTCCAGACGC
TGTTGACACGTTAGACATCACCCTTGTTTATCTATCCTACCTTTTCTTCTTGCGTACGTG
CCTCTCAATGCGTCGTGTGAATTATCAGTGACCGGTCGTGCCTATAATGTCCTGCTAATT
TCCCACTAAATCTTTCCCCATGGCGTATTCATCGTTATGTTTGTGTCTTTTGTTCAACCC
AAAGGGCTGTAGCAATCTTCACCCGTTTGTCGTTGATAACGAGTTTCCACCTTATCACTT
ATCACTAGTGCTAATCAAACAGCAAAGAATGCTTGATAGAAACCGATCCTGGGCTTATCT
CGCTGCATTGTGGCGGCATCCCTGGACTGTAATCAGCAAGTGTTGCTTAGTATATATATA
CATCCAGCGTCAGCTTGAATTTGGATACAGTTACTGTTTTTTCGATTTTCTCTTGGTTAT
TCTTTCTGAGACAGTAGTAATTTTGTATTACTGAGCGGGATATTGTTTATCTGCCGTCAT
ACTATATTACATTATATTATATCATATTATATATAAGAGA
Chromosomal Coordinates Chr XI from 506898-507707
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator