Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SET3
Systematic Name YKR029C
Description Defining member of the SET3 histone deacetylase complex which is a meiosis-specific repressor of sporulation genes; necessary for efficient transcription by RNAPII; one of two yeast proteins that contains both SET and PHD domains
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SET3	6322881 upstream sequence, from -1000 to -1, size 1000
AAATGAATTACAATGAACGTCGAAACAATAAGCCCACTCTACCACACTATTTTGGCTCGA
TTTGAATTTAAAATGTGACCTATTCAACAAAAGGTAAAAAATAGTTGCCATAATAAATCC
AAATATGAAAAAATCTAAAATCACCATCATTACCAAACTTTTGAAAAAATGACCTATAAT
GCTCAAGGCCCCCATATCACTGTCGTTGTTGAAACCTGAATTATAAATCGACCAAATAAT
AGAACTGAGTGAAATTAAGGCTATTTGGAAGATGAAAAAGGAAGGATCATCTCTCGCCCA
CTGATTTTTCGTCTGTCGCTGATAATATATTGATCTATAAGCTTTTCTTGGATGGAAAAT
CAAATGGAACATTTCCCAGCTGGCTGTCTCGAGATCTAAATTCTTTGGCGTTTTGAAAAG
CCTCCTGATTACCATCGGCACAGATTGCTGACCGTAGCCTTGTCTTGCATCGTTTTCATT
ACCATTATTACGCCTCCTCTGGCCTTGCGGGCCTGCTGGCAAGTCGTTGGAATAAGTCGG
CAAATATGACATTGATAAATCCGTTGACTAAGTAGTGGCAATCGAAAAATTATAGTGCAA
ATCTGTTTCTTTCTGGCTTTTTGCAGTTATTTCAACAAAATTTAAACCTGTTAAGTTTAA
TATTCTAGTAAGGTCTATTGGTAATTATTTAACCGTTGGAAGTGATCGTTGTATGAAATT
ATCATTCTAGATTACAGGTAGTCGATACCTTTTATTATAATACTTTTATAGCATGGTATA
TTATTCGTAAAAAAACATTAAAGACATGAAACTAGTCCTTTGTTTCCCTGGAAATTGTTC
AACCAACTCATTCATCTTACTATGTCATGATAGATGCATATCATTATCAACGACATGCTA
TATACAGAAAGTAGTAATAAAGGACCTTTCTAGTAAACATGATTTAAAGCGTATATACAA
CAGTTTTAGATCGTACTTCACAAAATACGAGAACTGAATC
Chromosomal Coordinates Chr XI from 499833-497578
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator