Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GCN3
Systematic Name YKR026C
Alias AAS2
Description Alpha subunit of the translation initiation factor eIF2B, the guanine-nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a positive regulator of GCN4 expression
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GCN3	6322878 upstream sequence, from -1000 to -1, size 1000
ATGTTATTGTCTCGTTTTTTTACTTTATATGCTTATTCTTTATCTTGTTACGTTATCAAT
GCTTGCATTTCAGCTTCTATTATATTTAATAACCGTTTCTCATTCTTAATGTCATCTTCT
TACACTGTGTATGAGAACATACTGCTAATTTGTGTGCTAGTGCATAGATGGTAGTTAATT
CTTATTCAGACAAAAAGTTTTAGTATCTGATCTGTTGTTAAACATGTTAGATAAGTATTT
TTTGGAATAAAGATCCACTATCGTATATTGGCTAGCGGTCGTGACACTAATATGTTATTA
CATACTGCATAAATAGAATACACAAATCGTGAGGTACAGTCATCCAATGTTGTGGAAGTC
GATACTCAAGACCTAAAGAAAAATAAAATTTCTGAATGAAAAACATAACGATAGTAAAAA
TGAGCGGTATGTTATGACATAGGAGATAGAAGAACAAAACTGATCTGATCAAATTATTTT
AAGAATATTTTACTAGTATGTTTACTACATGACAATCTGCAGCAGTGCCAGCTACATGGT
GATCTCTCCAAAACAGACCAAACAATTTGCGCTTGTATTGCTTTTCAAAATAAAACTAAA
CATATGTAATTGTGCTTACAAGAATTGCTAGCTATATCTTATGTTGGTAATAGATAACGA
TTAGTAATACCTTTTATGAGAAAGAATAAGGAGGCAATGCCATCATTTTCGCCACATTAA
GAGTGCACGACTCTATCCAGGGAATTTGATACAACACAGCAACATTGTCGCCATATTTAA
AGCTTTCTACATAGCATAATGTTTTTTTTTTTTTACAATAGATAAATTTCATCCGGAAGA
AAAATGAAAAAAAAATGAAAAAATTGGTGAAGTTTATGGTGTAAAATGAGAATCATACTG
CTCAAATAGTGACAAAGCCATCATTAATCATAGATTTCTTCATAGTAATTGATAGAAAGA
ATTTTAAAAGTCCTACGTATACCAGAAATCGAGAGGAAGG
Chromosomal Coordinates Chr XI from 489655-488738
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator