Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name URA1
Systematic Name YKL216W
Description Dihydroorotate dehydrogenase, catalyzes the fourth enzymatic step in the de novo biosynthesis of pyrimidines, converting dihydroorotic acid into orotic acid
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>URA1	6322633 upstream sequence, from -1000 to -1, size 1000
TTGTATTAATTTTCTCGAAGGGATTAGAATGTAAGTACATTTAAATAGCGCCGCAAGAAA
CATAACAGCCGTTAACACTAGCAAGATGGTAGATTACTGTGTCTAAGAATTTAAATTGTT
TTGCTTGCTTTTGCCACTATAAGACAATAATAGTAATAGAAAAGAAATGTTAGTCGAACA
GCAAATTGGTAAAAGTGGAAAAAATTATTTCGTTATTCATTTTAGGCCGTTCAGAAATAT
AGCATTTTGGTTCTTGCACTGAATGGGCCCTGAGGACAGTGTGCGGCTGGATAGCCATAT
ACTTCGACATTACTTTTCACCTTTGAAGGGGGATGTATGCTTATACACAATCAAAGCTCG
GCCTGTGCAGGTTTCACTACATAAGCTTTTTTACCATAGAAATCTTGCAGAAGGAAGTAA
GTATCAAGATATTACGTATCGCATCCATAGAACGATAGCAGAAAAATGCAGTATATGATA
ACGATATGCTTCACAGCTGCGGCCCATTTGGGGAAAAAAGGAAAAGGAGCATCCTCGATC
TTACAGATGTCGCTTTTTCCTCTTGAGGTCATTCCCTAACCTTGGGATCCAAGTCAATCT
GGTATCTTCCCACCCTAAATAGTGTATTCCCCATGTAATAAGATCGGACGATAAACTTCG
AAACAATTCTAGCCTTTTTTATTAGATATTTACTCTACTTTAGATTTGGTGATTTTACTA
AATGTTATCCTTCAGCCACTACAGCCTACTTTTTCTCACTAATATGTTCTTGAAGCCATT
TTCTTCACCGGGCTTTGCCGAAGGTTATTTCACGATCTTCGGCATTCGCCGAAAATTTTT
CAAGATGCCCATCACCAAAAAATAAAAAAAGCTTTATATATGGCATGGCATACGCATCGG
GAACCGGTATTCTTCTCTTGGATTACACAGTTTGGACTACTAGACGTTTCAAATAGATAT
ACACAATTACTCAAAAAAAAATTGAACTTCCGTACCAAAC
Chromosomal Coordinates Chr XI from 25215-26159
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator