Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MTR2
Systematic Name YKL186C
Description mRNA transport regulator, essential nuclear protein; Mex67p and Mtr2p form a mRNA export complex which binds to RNA
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MTR2	6322662 upstream sequence, from -1000 to -1, size 1000
ATTTCGAGTAAAAATATCACGCTCTTAGGTTCAATAAAAGAATATACTATTTCTTCAAAA
TGCTTCTCTAATCTATTTTTTTATTTTCCTTAATAACTGAAATATTATTTTTTGATGTAA
AATGAGTGAACAAGAATAAAGGATTTTTGGTATGTTTGCAAGTTCTGTGGAGTTCCATGT
ATAAGGTATACATATTAGAAAAGCTTTACGATTATATACTAACATCATGTACAAAACAGT
TTAATAATGATCTGTATTGCTGGCTCAATCCACGTAAGGAAAATGATCAGCCCAATCCTC
AAAAATAAAATGGCCCTTCCAAAATTAGAGACATATCGTAGAAATCAGACGCACGCTTGG
CGTCAATATCCTAAAACGGAAAACTAATCAGTTAGATGTGTCTTTTTTAGGTAAAAAAAG
GCAACCAACTTTTTGCTGGCTAGCGATGCGACAATAAACGCGCGCAGCGAATAAAAATAA
GATGGCGGAGGAGCAGAGACTTCTTTTCTTAGAAGAGGTTTTGTTACCGTATGGGGGTAT
GATGGTTAGATGGCTGAATAAAAACGTTAATTAAAGGAATACAGAAGAGGAAGCGCCCCG
ATTTCTTTTCTGTTCCACATGAAAGCAGCCGGTTGGGTGGTAGATCTCTAATGACATCCA
AACTACAAAACCGAGATTGGACATATAGCACACTCTGCATTTCTACTTTCCTTTCTCCCT
ACAGTTTGCTCGATCTGAACCGATGCTTCTTTGATTGGACAAGATGATAGACCATGACTC
CCTGTATGTATTGCAGAGATTGCCACTACTAACCAAGAAAAGTTGAACGTGTCGTACGTA
TAAAACGATTTATGCTTAGGCTTTACTGAAAAAAAAAAAGTAAAAAGAGGATGCGCAAAC
GCATAGAGCAAGTAACTAACCTGTTTTTATAGTATATACTTGGCCCCACCAGGCTGATCG
TCAGGCAAAACGCCAAACTAATAACAGTAATAACAGAAAT
Chromosomal Coordinates Chr XI from 93298-92744
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator