Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name VPH2
Systematic Name YKL119C
Alias CLS10, VMA12
Description Integral membrane protein required for vacuolar H+-ATPase (V-ATPase) function, although not an actual component of the V-ATPase complex; functions in the assembly of the V-ATPase; localized to the endoplasmic reticulum (ER)
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPH2	6322731 upstream sequence, from -1000 to -1, size 1000
TTTTTTCCATGCTAATTCTTGCCGCTCCTCTCCGCCCCTTCAAAAACACTCGGAAGGCGG
GTAGCATTAAAAGTCGAACAGTTTGTTGGTAACTTTTGTAGGTATATGTGTACCAATAAC
CACAAATTAAGTATTGATTATCACAGTCAACCTCTTTGTATATCAAAAATTATACTCTGT
ATTCATAAAAGGCAGTTATTTTAAAAGCAAGTAACGGCAGGAAAAAAATTATTAATAAGT
ATAAAAAGATTGGACGAGTCCGGAATCGAACCGGAGACCTCTCCCATGCTAAGGGAGCGC
GCTACCGACTACGCCACACGCCCTATTTACTGTTAGTGTATTTCCACTTAGATTACTATA
ACAAGCTCTTTTAAACAATAAAACAGTTCTATAACAACCGATTTACGAAATTCTTCTGAG
TAAATGAGGTCACAAATGAACTTTCTTTAACTTCCTCTTTGTCTCCATTCGTTTTTCCAT
GCTTTTTTTGTTTCTGTCGAAATGAAATCCTTGTATCATCTATTGGCTAGTATTCGTCTT
CCTAGAATATTATCACAGCGGTGTAAGATGATGACATAGAGATTGGGAAACAGTTATCGG
TCTTAATGGAAGCTGAAATGCAAGGATTGATAACGTGATAGGGTAATGAATGGCAAAGTA
TAGAAGAAAAGAAGTTAGAGTAATATTATCATGTAGAAAGACCGATTCCATTTTGAGGTT
TCCTATACCCTCGAGGGGAACTTTTAGGATATTCTGTGTATCTCATACTATAGTCTTTAA
CTATGATTGAATCCGAACAATTATATTGTTCACGAAATACTCAGTTTTACAAAAATCTTG
TGTATTTAACTGACTCAAAGTAGACATGACGGACGTGTGAATATTTAAAATGAGAAACGA
GGAAGCGAAAATAAAGCAAATCTCACATGAAAACGCTGAAAGAAATGAAGAAAAGGTAAG
ATAGGATAATTGACGATTGGCATCACATAAAAGAACTCTA
Chromosomal Coordinates Chr XI from 219217-218570
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator