Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GFA1
Systematic Name YKL104C
Description Glutamine-fructose-6-phosphate amidotransferase, catalyzes the formation of glucosamine-6-P and glutamate from fructose-6-P and glutamine in the first step of chitin biosynthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GFA1	6322745 upstream sequence, from -1000 to -1, size 1000
ATGGAGACAAAGTGCAATATTTCCAAATCAAAAACAACTCAAGATCAGGTGGTACTATCG
GCCCATCATTGGCTTCTCAAACAGGTGCTCGTACCATAGACCTGGGAATTGCACAGTTGT
CCATGCACAGCATCAGAGCTGCTACAGGGTCCAAGGATGTCGGATTAGGTGTTAAGTTCT
TCAACGGATTTTTCAAGCACTGGAGATCAGTCTACGATGAATTCGGCGAGTTGTGATTTT
GCCACACTCTTTTTATTTCTTTTGATTTCTGTTTCTTTATCCTTTTTCTAAAAATACTTT
TATTTCGAATCAGGAAGAAAAGAAAAATGTATAAAAAAAAAAAAATAAAACACCACAATC
GTCAAGATATAAATATCTATTTATAAATAAAACATCAAAAATACCTAAACCCCAAACATT
CTACTAGGAAAGAATATTAACAGTAACCACGAACTATAAAAAATGCATTTGAACACCAAT
GTGGGCCTTGACAGCCGTATTAGATGAAACAAACCACATACTTTTCTTGATTAGCCAAGC
ATTCTTTCTTTTGTGACGCCGTCGATCACTCAAATATCAATCCGGGTAACGCGCGGCTCC
CTACATTTTCTTCGATTTTTATCTTTTTTTCACAAATCGAAAACATTAGACTTCCTCTTT
GGGAAATCGGATGCATTTTAGCGTTTCTGAGGCGACTTTTCCTCTTCTTAAAATATTTAT
TTAGTGTCTTACATTCGACCCTTTTCGCCTTTCTGCTTTATTTTTGGAACACGTACTTCT
TTTCGCTTACAAGAAAGCATTCTCAGTCATCCATCACACTTATTTTCACTGCAAAGTTAC
AGAACCGGTGTCCTTTCCAACATCATAGTTATATAGTTGAGAAAAAGTGGACAAAAAGCC
AGCATAAACAAGGAATAACTGTATTTCTTTTCTTATATAGTTATCAGGGCCAAATAAGCA
ATAAGTTCTCGAGCAAATCAACAGCAACTTTTATAAAAAA
Chromosomal Coordinates Chr XI from 245373-243220
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator