Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NUP120
Systematic Name YKL057C
Alias RAT2
Description Subunit of the Nup84p subcomplex of the nuclear pore complex (NPC); required for even distribution of NPCs around the nuclear envelope, involved in establishment of a normal nucleocytoplasmic concentration gradient of the GTPase Gsp1p; the Nup84 subcomplex has a role in transcription elongation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NUP120	6322793 upstream sequence, from -1000 to -1, size 1000
TCTGGGGTCTCAGTTGCGGTTAGCAGATTAACACAGAACATACTATAGACAAATATGATT
ATTTACAAGGATATCTTCTCTAACGACGAATTGTTGTCTGATGCTTACGACGCTAAGTTA
GTTGATGACGTTATCTACGAAGCCGACTGTGCTATGGTCAATGTCGGAGGTGACAACATC
GATATCGGTGCTAACCCATCTGCTGAAGGTGGTGACGATGATGTTGAAGAAGGTGCTGAA
ATGGTCAACAACGTTGTCCACTCTTTCCGTCTACAACAAACCGCTTTTGACAAGAAGTCC
TTCTTGACCTACATTAAGGGTTACATGAAGGCTGTTAAAGCTAAGTTGCAAGAAACTAAC
CCAGAAGAAGTTCCTAAATTCGAAAAGGGTGCTCAAACTTACGTCAAGAAGGTTATTGGT
TCTTTCAAGGACTGGGAGTTCTTCACTGGTGAATCCATGGACCCAGATGCCATGGTTGTC
ATGTTGAACTACCGTGAAGATGGTACCACTCCATTTGTTGCCATCTGGAAGCACGGTATT
GTGGAAGAAAAGATCTAAGTCTAGCGAAATTAGAAAAATTTTCGTATTTTGTATTTGAAT
TTGAGAGTAGGACTCCCCTTTCTCATTTTTAATGTATATGTAACCTCTCTCTCTTTTTTC
TCTGCATCAACTTTTTAGCTTCTATTCTTTGATTCTATAGGTATCTAAACTTCCTAATTA
CTTCTTAACACGCATTAGGACGTTTTTAATTATTCTATGATTTTATTAAGACACGTTTAT
CAATTGCCGTAGATATGTATAGTTCATCAATATTTTCTTTTCCATTACCCTACAGAACTT
TCATGTTTTTTGTTTTCCTGTCTTTTTCTCCAATTACGTGAAAAAAAAATTGAATTGAAA
TAGCATGAGAAGCTGAGAAACAAGTAGAAATTGACGAAATCCAACGTTCATAAGCATTTT
TCAAGAGGTCGCAATTTCACTCGTACACAACTGACCTATT
Chromosomal Coordinates Chr XI from 333969-330856
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator