Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UGP1
Systematic Name YKL035W
Description UDP-glucose pyrophosphorylase (UGPase), catalyses the reversible formation of UDP-Glc from glucose 1-phosphate and UTP, involved in a wide variety of metabolic pathways, expression modulated by Pho85p through Pho4p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGP1	6322815 upstream sequence, from -1000 to -1, size 1000
GACTTTCGTCCACGACCAGAAACGACGTCATGTGGCCAAAGTCGGGCCAAGGCCTCCGCG
AGTCATCAGTCATGAAGACATTGCTTGATGAACGCCGTACTTCTGGTACACAACCGACAA
CGGCGCCAGTAGCCGCAGAGGAACCCAGGCTTGAGAACGTTGCCCTGGAAAATTTCGTTA
GTATCGGCTGGAAGCTGTTGGACGATTCCGAGTTAGGCTGGTATTGACAGGTAACTATGC
TCCCTTCTCCTGTAGGTCAGGTTCTCCCTTCTCCTCAGGCAGAAATTCGCGTAAAGAACT
ACCATGCAATGAATGACCAATTTAAGTAAAACACATAAATAATACTTACTTACACATATA
CACACTAGCTGTTTTAACCTGTAACAATACTGCCTTGTCAGAGTGCGCACGGCCTTTTAC
TCTGGTGCTCCACCATCTTCCACGGTATTCGAGAGTCGCCAAGCTCAGGGGCGCATGCAG
ACAATGGGCGGGGAGCACCTTCTTCTTTCACAGCTAAAGGGGTCTTTCTTTCTCCTACTT
TTGGCATACTTTTTCAGGGGCAGAAGTCCTTATTACGCACGTTGCTACCGCCGGCTTGCT
GTTACACCTGGTGCCATCACTATTGCCATTGCCATTGCTACAGATTCAATTCCGGCGCTT
GCAAAGTCCAAAGTTCTGGTGTCGGTTTGTTCTCACACAGATCCCTGTACAGCGTCTTGT
AACCTGATCCCCTTCCCCCGCCCCTTCTCGAACAGCCTGACGCGCTTCCTCTTTTGTTTG
GGCTCGGCCCGTTTTTGCATTTCCTTTCCCTGTTTTGGATTGAGTATATAAATCTAAACA
AACAACAAAGTTCTTCCAGCAGGTACCATGAGATTGAAGTTACGGTTTTAGGAGTTGGAG
ATTCAATTTCTGGTTCTTTCCACATCAGCAACGTTAAAAGGCCTAGTCCTCTTCCGATTA
TATAATATAACTTCCACAGCAAGTGTACCATAACATAATA
Chromosomal Coordinates Chr XI from 369891-371390
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator