Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS4a
Systematic Name YJR145C
Description Protein component of the small (40S) ribosomal subunit; mutation affects 20S pre-rRNA processing; identical to Rps4Bp and has similarity to rat S4 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS4A	6322605 upstream sequence, from -1000 to -1, size 1000
GGAGAAGTGAGCCCGTTCTGGAGATATATGTCCAAATATTTGCAGATCCAGTTTTGTCAT
TATAATGAGATGCCTTTTGGGCGACAAAGTTCGGGTAAAAGAAGGACGGGTCCAGGAAGG
CCGTGGCCACAGAACAATGCGCAGAGAAGATTTCCGGTTTCTTTTTGGCTTTTCCGACTT
TCATCTTTTAGAACTAAAGATTTCCTGCATCGGTAAACCTTAGCAATGTTTCTCTAGAGG
GTTTTTGCACACCAGACACGTCGCACGTGCTCTTGCAGAGACTGCTGCGCTTTCGTTTAC
ACTCAGATAACATAGTCTAGCTAGCTTGCTGTCGTTCGGCACGAGATCTAATCCTTCTCC
TGGCCTACCGTCTGTGCAACCATTAGTCATGATTACGTGTGTTGCGCCTTATCTTGTCAT
TATGGCAGCATACTTTTCGTAGTCCTTTCCTGCGCAGCTTGTCCATTTTCGTCATTACGT
AAAAAGTCCTAATGGAGAGCTGGGTACTGCATTTTTTCGATGTTTTCAATATTCAGTTCA
GCAGGAAATAAACAAATAAACAAACATTAAAATATCCTGGTTTTTTTTCCCAGAGACGCG
TGGAAGCACCCATGCATCCACTATTTATTTTTAAACAGCCGTACATTCTGTAATTTTGCT
TCCTTTTTCTTCCTGCGTTCTTTTTTTCTTGAACTGTCGTTTTCCGTTATTTTTTTCGGT
GACATCAGTTGAAAGTAGCAGCGGCCTAGGCCGGGAGGCCGTGTAGCTCTTTGTAGTCGT
GGTAAGGGGGAGTAGCAATTCACTTAGTACGTGGTCTTGGAGTTAGGCTGGCTCGGACTG
GCCCTGGCAAGTCCTGTTCTGTGTGGTAGTATTGAAATTTCAGAGATTGTCGGCAATACT
AGTATATTAAAAATTATACTATAATTTAATCTAGTGTTGAAATACTTTCTTATATAGCGA
TTTTTCTGCCCAAAACAAACCAAAGAATCAATACGCAAAG
Chromosomal Coordinates Chr X from 702798-702027,703068-703055
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator