Yeastract IST IBB-BSRG INESC-ID
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS4a
Systematic Name YJR145C
Alias eS4, rp5, S4A, S4e, S7A, YS6
Description Protein component of the small (40S) ribosomal subunit; mutation affects 20S pre-rRNA processing; identical to Rps4Bp and has similarity to rat S4 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS4A	6322605 upstream sequence, from -1000 to -1, size 1000
GGAGAAGTGAGCCCGTTCTGGAGATATATGTCCAAATATTTGCAGATCCAGTTTTGTCAT
TATAATGAGATGCCTTTTGGGCGACAAAGTTCGGGTAAAAGAAGGACGGGTCCAGGAAGG
CCGTGGCCACAGAACAATGCGCAGAGAAGATTTCCGGTTTCTTTTTGGCTTTTCCGACTT
TCATCTTTTAGAACTAAAGATTTCCTGCATCGGTAAACCTTAGCAATGTTTCTCTAGAGG
GTTTTTGCACACCAGACACGTCGCACGTGCTCTTGCAGAGACTGCTGCGCTTTCGTTTAC
ACTCAGATAACATAGTCTAGCTAGCTTGCTGTCGTTCGGCACGAGATCTAATCCTTCTCC
TGGCCTACCGTCTGTGCAACCATTAGTCATGATTACGTGTGTTGCGCCTTATCTTGTCAT
TATGGCAGCATACTTTTCGTAGTCCTTTCCTGCGCAGCTTGTCCATTTTCGTCATTACGT
AAAAAGTCCTAATGGAGAGCTGGGTACTGCATTTTTTCGATGTTTTCAATATTCAGTTCA
GCAGGAAATAAACAAATAAACAAACATTAAAATATCCTGGTTTTTTTTCCCAGAGACGCG
TGGAAGCACCCATGCATCCACTATTTATTTTTAAACAGCCGTACATTCTGTAATTTTGCT
TCCTTTTTCTTCCTGCGTTCTTTTTTTCTTGAACTGTCGTTTTCCGTTATTTTTTTCGGT
GACATCAGTTGAAAGTAGCAGCGGCCTAGGCCGGGAGGCCGTGTAGCTCTTTGTAGTCGT
GGTAAGGGGGAGTAGCAATTCACTTAGTACGTGGTCTTGGAGTTAGGCTGGCTCGGACTG
GCCCTGGCAAGTCCTGTTCTGTGTGGTAGTATTGAAATTTCAGAGATTGTCGGCAATACT
AGTATATTAAAAATTATACTATAATTTAATCTAGTGTTGAAATACTTTCTTATATAGCGA
TTTTTCTGCCCAAAACAAACCAAAGAATCAATACGCAAAG
Chromosomal Coordinates Chr X from 702798-702027,703068-703055
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator