Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SOD1
Systematic Name YJR104C
Alias CRS4
Description Cytosolic copper-zinc superoxide dismutase; some mutations are analogous to those that cause ALS (amyotrophic lateral sclerosis) in humans
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOD1	6322564 upstream sequence, from -1000 to -1, size 1000
TCTGGAGTAAAGAAATTGGCAGCACCCAAGTCAGTGACCAAGGACCGGTTATGGCCAGTG
ATTAATGCGGCACACTTACCGGTACCAATATCATTTTGAACTTGGTACATAGACTTGACA
CCAGCTTTTTCGTTTTCGTTAAGCAATCTCTCGCTGAACTTGTCCTTACCGACGGAACCG
AAGTACACCACCTGGCCGGCGCCCAAAACGTATGCTGCCCCTCTAGCAGTGTTTTGAGCA
GCACCACCTGCAACAAGCTTTGTTTCTGGCATCTGTAAGAGCTCGTCAAAAATAGCCATC
TTAGCATCGCCTGATTTGGCATCGACCAAAATTGCGTCGTTTTCCTTTAGAGAATACTTG
GCCAGGTATTCAGCCGTGACGTCGGCTTGGAAATCTAAAAGTGGGTTACCCAATACTACC
AATGGTGCGGTCATAATTGCTTGCTCTTTCTTTTGCTGTTATCTTTGGTTCTACCCTGCA
CAAGATAAACTGAGATGACTACCTAATTAGACATGGCATGCCTATAAGTAAAGAGAATTG
GGCTCGAAGAATAATTTTCAAGCCTGCCCTCATCACGTACGACGACACTGCGACTCATCC
ATGTGAAAATTATCGGCATCTGCAAAAAAAGTTTCAACTTCCACAGGTAATATTGGCATG
ATGCGAAATTGGACGTAAGTATCTCTGAAGTGCAGCCGATTGGGCGTGCGACTCACCCAC
TCAGGACATGATCTCAGTAGCGGGTTCGATAAGGCGATGACAGCGCAAATGCCGCTTACT
GGAAGTACAGAACCCGCTCCCTTAGGGGCACCCACCCCAGCACGCCGGGGGGTTAAACCG
GTGTGTCGGAATTAGTAAGCGGACATCCCTTCCGCTGGGCTCGCCATCGCAGATATATAT
ATAAGAAGATGGTTTTGGGCAAATGTTTAGCTGTAACTATGTTGCGGAAAAACAGGCAAG
AAAGCAATCGCGCAAACAAATAAAACATAATTAATTTATA
Chromosomal Coordinates Chr X from 623014-622550
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator