Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GRR1
Systematic Name YJR090C
Alias CAT80, COT2, SDC1, SSU2
Description F-box protein component of the SCF ubiquitin-ligase complex; involved in carbon catabolite repression, glucose-dependent divalent cation transport, high-affinity glucose transport, morphogenesis, and sulfite detoxification
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GRR1	6322549 upstream sequence, from -1000 to -1, size 1000
AGCGGCTTTTCAGGCAACGCCAGTAATGGATATGCTATGAACAACGATGACTTAAGTTCC
CAGTTTGATATGCTAAACTTTAATAACGGAACCCGTTTATCGTTGCCACAACTGAGCCTA
ACTAACCATAACAACACTACTATGGAATTAGTAAACAATGTTGGCTCCTCACAACCTCAT
ACGAACAACAACAACAATAATAACAACACGAACTATAACGACGATAACACCGTTTTTGAA
ACTCTGACTTTACACTCTGCAAACTGACGTCCCCATGTTTTCTTTTATTTCCGTCATCAT
TGGGAGACCACGCCGTTTTCTTCTCATACCTGCATCCATTCAAAACTATCTCATTTACCC
CCAACGGTTTTATGGTTCAAATCCTAATAGAATATGAGCGAGCTAATGAAGAATTTGGGC
ATTTTCATTACTGGGAAGACGTGTCTTTTTCAAGCCATCATATCGCCAAATTTTTTTTCT
ACACCTAATCATGATTAAATAAATCCATAAAGTTTTATACAGTTTTTAAAAATATCATCA
TTTATTACCCAGATGTGTTAATGAACATTTATAGTCATCATTACTAGGCTTTCATTACTA
CTGAGGTTACCCGCCTATGGACCTTCCTTGGTAAAGGAACTTGTTTTAAAATTTGCCTTT
TAACAAATTTAGTGATATGATTATCAAAAAAGGCGTGGCAAAATACATAACACCAAATTT
AACTGTGCCTGTGTGTTACTTTCTTTTGTCCATACTTCACCAGTTTTTCGATTTTACACA
ATAATTCGTTTTCATTTAATCGTTCTCTTAGAAGCCCGGTTTTTGAATATCAAAATCGTA
CTTGTGTCCAACTAGCAGGGAAGCCCAAAAATTAAGGCATTGCATTTAAGCTTACACCTG
CGTGAAATCTTGAAATTTCTCATTGATTTCGGCACAATAATTATCATTGGTAGTGAGGCT
AAACAGTTTTGCGGTTTCCTTTATACTAAGAAGGTCTATA
Chromosomal Coordinates Chr X from 594327-590872
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator