Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CDC11
Systematic Name YJR076C
Alias PSL9
Description Component of the septin ring of the mother-bud neck that is required for cytokinesis; septins recruit proteins to the neck and can act as a barrier to diffusion at the membrane, and they comprise the 10nm filaments seen with EM
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC11	6322536 upstream sequence, from -1000 to -1, size 1000
TCTACTACGGGTTCGCCGGTCCAAAAGAAAAATTGTCCTCTACTTCCACTACTTTGTTGA
ATTTGCTTTCCGGTTTGACTGCTGGTTTGGCCGCTGCCATTGTTTCCCAGCCAGCAGACA
CTCTGTTGTCCAAGGTCAACAAGACTAAGAAGGCTCCTGGCCAATCCACAGTCGGTTTGT
TGGCTCAGTTGGCCAAACAGTTAGGATTTTTCGGTTCCTTTGCTGGGTTGCCTACTCGTT
TGGTCATGGTTGGTACCTTGACCTCCTTGCAATTTGGTATTTATGGTTCTTTAAAGAGCA
CTTTGGGTTGCCCACCAACCATTGAAATTGGTGGTGGTGGTCATTAGAAATGGTCTTGAT
TGATACATGCATATATATTCTCTCCTCATCACCACCGGAGCCCCTTTTTTTTTTCATATT
CTAAGAAAGAGTCAACAAAGGAAAGAAATAAATAAATCTGTTTAAATGTACTCTATTCAA
TCACTAGTATTCTTATTCCATGTATTTACTGACTTTGCAAAAGTCCAAATATCTGTAAAT
TAACATGCTATTATAAATATATATATATATATATATTTGAATTTTCTATTTTTTCATCTA
CAAAAGCAGGTTATAGCTCCGTTAAACCCTTTGCTCATTGAATTGTCCTTCACGGTTTTT
TGGTGGAAAACACAACATGGAACATAACATTTAAACATCGTTCTCAATCCATTTCATCGC
AGTAACATATTTGGTCGGGCACATACGGACACGTATATGTTATACAGATAAATATAGCTT
AAATATGGCTATATTTACACAACACAATGCTCGTGGGTCGTTACCCGACCATGCAGGATC
GCCAGTATTCTTTATTTTTCCGCCTTCTAACATAAAGAAAAATAAACAAAAAAGTATTTG
ATCGAAAAGTAAAATAGGTAGACACCACGTATTGGCGACCCGATCTGGAGCCGTTTAGAA
AGTCAATCATCACAAGGCCTAAAGTTGCTAACCACCAGCC
Chromosomal Coordinates Chr X from 576601-575354
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator