Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YAE1
Systematic Name YJR067C
Description Protein of unknown function, essential for growth under standard (aerobic) conditions but not under anaerobic conditions
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAE1	6322527 upstream sequence, from -1000 to -1, size 1000
GAATGTCATGAGGTACCACACCAGCTAATTCTTCCACTTGGGTAGAAGTTATGTTTTTAC
CATCACCCAAGTATTGCGCCCCCTTGGAAGCGGATTGTAATAATGTAATGCCTCTTCTCA
AGTCACCTGCCGAAATGTCCAAGATCCTTTCCAAAACTCCATCATCACATTTAACATTTT
CTTGTTCGCTGATAAACCTCAAACGGTCAATGGCATTACTTGCGTCTAGGGCTTTGAATC
TAAATTTGGAACAACGGGACGCTAGCGGGTCAATAATTCTTGTCACATAATTACAAATCA
AACAGAATCTTGTTACTCCTGAATAGGTTTCCATTGTTCTACGTAATGCACTCTGTGCAT
CGGCAGTCATTGAATCGGCCTCATCGAGAATAATGATCTTATACGGTGGGCACGGATAGT
TCTCCAAGTCATGTTTGCTAGGCTTGGATACAGTCAATCTTGCAAAATTTTTTACCTTTT
CTCTTACAATAGAGATACCACGTTCGTCAGAAGCGTTCAACTCCAATATTCTTGATTTCA
TCAAGTCGGGTCCATATAATTCTTTTGTTAGCGCTAAAATGGTAGACGTTTTACCAGTTC
CTGGGGGACCATAAAACAACATATGTGGTAGATTAGCTGACTTTAAGGTTTTCTTCAAAA
CAGTAACGGCATGATCTTGAGCTGTCACTTCATCTAGGTTTTTGGGCCTGTATTTCTCAA
CCCAGGGTTGTTGTGCCAATGATTGCTCTGCGGCTAACTTTGATATCTTACGCTTTTTAT
TTGGACCAAACCCTTCAAACATCTCAAGTGATTGCCAATACTTTCCCCCAGTATTTCTCG
CTGTCTCTCTATTTTACTTCTCTTATAGCATTGACTTGTTCGCTTGAGTTACTTCCTGAT
TGCTTTGAAATACGCGAAGTAAAAGAGTGAAAAATAACGATGAGAAAGGTTTTTGATAGA
AGAGAACAAAAAAGGAACAGTGTTACAATAGTATATAGAG
Chromosomal Coordinates Chr X from 567444-567019
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator