Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CCT5
Systematic Name YJR064W
Alias TCP5
Description Subunit of the cytosolic chaperonin Cct ring complex, related to Tcp1p, required for the assembly of actin and tubulins in vivo
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCT5	6322524 upstream sequence, from -1000 to -1, size 1000
ATGTGTGAAACTAAAGTGGTTTTATTTCCAAAGAAGGGTTATCCCTTACTAGGGCAACGA
ATGAATATCTATTAGGGCTATAAAACAAAAATAGTTAAGTGAGATATATACCCTCTTGAA
TGGTGCAGGGTAAATAATTATATATCGTTACGAACGAAAGATGAAAAATATGAAAAAAAA
AAAAATCAAATTTATGTCAAGTGAAGGGCATTGCATGGCAAGTGTAAAGAATCCAAGAAG
AAAAGAAAGGCTTAAAGCAATCCAGGTTAGTACTTATAAGAATGTCTGTTGTAGGATCGT
TAATTTTTTGCTTGGACTGTGGTGATCTCCTGGAAAATCCTAATGCCGTATTAGGCTCTA
ACGTTGAATGCAGCCAATGTAAAGCCATATATCCCAAGTCACAATTCTCCAATTTAAAAG
TCGTCACCACGACGGCAGACGATGCGTTTCCATCTTCTCTTAGAGCCAAGAAATCCGTGG
TTAAAACTTCTTTGAAGAAGAACGAACTGAAAGACGGCGCTACTATCAAGGAAAAGTGTC
CTCAGTGTGGAAATGAAGAGATGAACTATCATACTTTACAGTTAAGATCTGCAGATGAAG
GTGCTACTGTCTTCTATACATGCACTTCCTGTGGTTACAAGTTCCGTACCAACAATTGAT
TGGGTTGTGTTCGCACATATTACAATTTGTACATTAATATCATCCCCGCTTTCATCATGT
GAACATCTATAGAACATCATTTATAAAAACAAAAAATCTATGTACTGACGATATAATAGC
GTACATTATCATATTATTCTTACTATTTATCATACTCATCGCATCTACTGTTCTCGAGAA
CGTGTAAAGTGATTTATGCCATTGAATGAAAAATTTTGTTAAGGAACAACTAGAAATATA
ATAGTGTCTTGGTGGATGTGGCAAATGAGGTGTGCGTGATAAAGAGCTACAAACTCAAAG
TAATAACAGCTATCATCCATTTTTATAGCAATATTTGAAA
Chromosomal Coordinates Chr X from 555914-557602
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator