Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BFA1
Systematic Name YJR053W
Alias IBD1
Description Component of the GTPase-activating Bfa1p-Bub2p complex involved in multiple cell cycle checkpoint pathways that control exit from mitosis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BFA1	6322513 upstream sequence, from -1000 to -1, size 1000
TACGCACCGCTTCACCGACAAATCATTATCTAATTTATTGATCAACTGCGGTTCTACCTT
GGTATCCTTAGGGTTATCCAGACTAGATTCTATATCAAATTACGCTTTATTACCGCAGTA
CCTAGTCAACGACGAATTTCACAGTCTCTGTATTGAATATCCATTCAATGAAGAGGATGT
TAACGATGAGATCATCATAAATCTGCTAGGTCAAATCGGGCGCACGTTACGTAAATTGGT
TTTGAATGGCTGTATTGACTTGACAGATTCAATGATAATCAATGGTCTGACTGCATTCAT
TCCTGAGAAATGTCCATTGGAGGTATTGAGCTTGGAAGAATCAGATCAGATCACTACAGA
TTCACTGTCGTACTTTTTCAGCAAAGTAGAACTGAATAATTTGATTGAATGCAGCTTTAG
AAGATGTCTACAATTGGGCGATATGGCAATTATAGAGCTATTGCTTAACGGAGCAAGAGA
TAGTCTGAGAAGCTTAAATCTCAATTCATTAAAAGAGCTAACTAAGGAGGCATTTGTGGC
GTTAGCCTGTCCTAATCTGACGTATCTTGATCTTGGTTTTGTACGTTGTGTTGATGACTC
GGTGATTCAAATGTTGGGTGAGCAAAATCCGAATTTAACTGTAATTGATGTTTTCGGAGA
CAATTTGGTTACTGAAAAGGCCACAATGAGGCCTGGACTTACGTTGATAGGGAGACAGAG
TGACAGTATATAATAAAATAAAGACATATAAAACGTGTATTAGATAGAAAACGGAAAATT
GACTAATGTTTTTATTCCTATTATACTCAGATCGTCAAATGTTGCCTTTATTTTCTATTG
AAGGGATTTTATGGCATCTCGCGAATAATAAACAAACAATAATAGTAAAAAAAAAAGTGT
AAACTTATGTATTCAGCGCAGATAAAAGGAAAAAAACGAGAAGTTTGACGTAAAGAAAAA
AGTTCGAAAACTTTTGTAGCAGTTGAAAGTTTTGTATGCT
Chromosomal Coordinates Chr X from 534027-535751
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator