Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name AVT1
Systematic Name YJR001W
Description Vacuolar transporter, imports large neutral amino acids into the vacuole; member of a family of seven S. cerevisiae genes (AVT1-7) related to vesicular GABA-glycine transporters
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AVT1	6322460 upstream sequence, from -1000 to -1, size 1000
AGCATTCGCTATCGCAAGCCATTAAATGGGACGGATCTTCCGGTGGTGTTATAAGAATGG
TTGTTTTGACAGCTGCTGGTGTGGAACGTTTGATATTCTACCCTGATGAATATGAACAAC
TATAATAGACCCCAAAAGAACAAATTCTGAGTGATTACTTCTCTTTATATTTGTTAACAA
ATGCCTCTGGATCTACACTGATATAACATATAATAGTCTATAACCTCTTTCTCTTTTTCT
CTTCGCTTTACGCTTTTTTCTCTAACTGTTAGAACGACAAAGTATCTCAGAAGGGAATTT
CGTAAGCAAGATATTTTACGACTAATCATTTTTTTGTTGTATAAAAACGTATGTGAGATT
GATTCACTAATTCTTCGGAGTCCTGGAAGGCTTACCTTATCTATGCATTCGTACAGTTGT
GTGCAATGTTAAAAATGGTGACTGTATCTACGTATCTATAAAAAAAGGTTAACTACCGGA
AAATCATTTCTTCTCGTAAAGTGTATATTTAGGTTCGGAAATCATAAACATTGTTTTTTT
GTGTTTTTTATTTTTAAATAAAAAGAATAAATATTTTATATTAAAAAATAAATTTTAAAG
TAAATTAATTATTTAACACGTGATTAAGTTACTCTAATATAATCCTATTTAATAATTAGT
AGAGTTGTTGAGAACGAGTATAATATTATTTTTTTTTTATTTTTTTGTAGGTTCTTTGGC
CATCCTAAATAGAATAAGCATCCACAACAACTAAACTGGTATTTTGTTATACACAACGCG
TCTTGGTTAGGCATCTGTTTTGTTTTAGCTATTGTTCATCGCGTTTTTTTTTTTCTTATC
TCTTTTACCGAGGGGCGAAAATAGCGATAGATCGAGAATATAAATAAATAAAATATTGTT
GTGTTGTGTAGTTCTAAAGAAAAATTTTACAGTGAAAAGGTAACACCGGGGAGTCATTAC
GTAGACTTACGTATTCTGTATAACTGATTCCGAGACGCAA
Chromosomal Coordinates Chr X from 436802-438610
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator