Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEX2
Systematic Name YJL210W
Alias CRT1, PAS5
Description RING-finger peroxin and E3 ubiquitin ligase, peroxisomal membrane protein with a C-terminal zinc-binding RING domain, forms translocation subcomplex with Pex10p and Pex12p which functions in peroxisomal matrix protein import
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX2	6322250 upstream sequence, from -1000 to -1, size 1000
ACCACGTTCTCCAGTGGTTGAGGCGGATGGTGGGGTCATCCTCGATGGACACCGCCGATC
TCACTTCAGGATATGGAGAATTGGGCAAGTATGTAGGGTCGCCCTTCCAAACGAGACCTT
CCTCCTGTATGGAATGCCTGTCGAATTTTTGGCTTTCCGGATCGCGGTCCTCCTCATCAG
TAGTCGCAGTGAGATTATTGACGTCCTCGTCAATATTCTTAACGAAAGCATCTTTCTTTT
CCTCTTCCATATTGATCTGGATAGGAATGGTTGTTGGCGTTGGCGAGGGCTCCGACTCCA
ACGAGTCGCTCTCCCTATAAATGGTACTCATGTGTTCTGTGACGTTATATAATTGTTGCG
GTTATTTTCTGCCACACAGTCGAAAACTTTTTACCAAGAATACACAGCTTCCGATGATTG
TCCATATATAGTCGAAACAATTCATTGAATAGCCCAAAATTTGAAAAAAAAAGAAAAATG
ATGGGCACCCCATGATGATAAGAGCTCTCTTTCTTCAACAACGATTGCTAAGGCGTTTAC
AGACCCATCGACTGCCCTTGCAGTGGGTTTGATGTGATTAACAGGCAGCAGCAACAAGCA
ACTGCTGAAAACCTTGGTGCCTTGCAGACGGCTATTGTCCTGGATTTTGTGTGACAAAAC
GTAGATGTGGCGTCTTGTAGTCGGAGGTGTGGCGGGCCGGAAAAATAGTGGAAAAAAAGA
AAATTAATGCGATAGCGACGGGCAGGTAGGGAGGTTTGAGGGGTCCGTAGTATGCGTCTA
TCGTTGCAACAAGGGTGACTAATGCCATGTCTTGGCCTTTGATGCAACGTCTCGGAAGTT
AGTATCGATCCGAGGAGTGGAACGGATGCGATTTCCCCTCCATTCTATCGATAAGGTTGC
TGGGAAACGCATTATAAGGGATGAGTGAAGACGGAGGGAAAGCATAACGAGGAGAGATTG
CCGAGATAACTGAGAAGACGTAATCTAAAGGCAACGCAGC
Chromosomal Coordinates Chr X from 36919-37734
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator