Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SWE1
Systematic Name YJL187C
Alias WEE1
Description Protein kinase that regulates the G2/M transition by inhibition of Cdc28p kinase activity; localizes to the nucleus and to the daughter side of the mother-bud neck; homolog of S. pombe Wee1p; potential Cdc28p substrate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWE1	6322274 upstream sequence, from -1000 to -1, size 1000
ATAACCAACTAGAAGACACATCATTATGCACAGAACAAAAAAATAAAATTAGCACTACTG
CGCTCACGATGACCTGCAGGATTTTTCTCTTCTTTAACCTAATCAGCATTGTAACCTGAA
CTATTAGTATATCCTCTTGTTGTGCTAGGAACCAGTCGTAAAATAAAAATTTCCAATAAC
CGTGAAAATGCTTTTTTCATATCTGCGTATATATAAAACACTTTAAAGCCGTGTTGATCC
TTTAGTTGTTACACTTTTTTTTCCCCGCCGATGAGAAAGTGAAAAAAAAAATCCGCAAGA
ACGGGGAAAAAGATAAAAGAAGGCACTTATCTCTCTGAACTCTGCACCGAAACATGCATC
TGTCGTCTATTCCGACTTGGCAACCAAAAGAAGCCCAAGAGCTAGTTGCACTTAAATCAG
TAGAATCGTGAGATTGTTTATTATCTTACTTCTGTTAGAGTGCTTCGCTTTCCATGCATC
AAACTATGGATTTGTGCTGATCTTGCAACCATCGTCCTCTAAGGAAAGAAATGTGGCACC
TTTAAATAGGTTCCACCTCACAGATGCCAACATGTGGGAGATAGGGGGCTATTCGCAATT
TATTAACGTCTCTAGTACTGGTAAGCCTTTCTAACATTCTTGTGGTCACGTGATGTGTAT
GTTTCTTTTTTTTATTCCTCCGGGTGATAACGACGCGAAAAATATTTTTTCATTTTTCTT
TTAACCATCACAATTTGCGACGCGACGCGAAAAAAATGCAGAGAAGTAAAAGAATGCTGG
ATAAGAAATCAACAACACAGTTGAACATTGGCGTGCCCCTGTGTATTAAGTAAAGGTTGT
CCAAGAGGCTCTTTTTTGTATGTATGCGTGTGTTAACTATCCTGCACATCATCTTGCGCA
GTTAGTCCAATAAAAAAGGATTACTACTGAACAGGTCTTACTATTTTTGATTGCGTAGTG
CTGGGGAAAAGTAAACACACACAGGCGCACACGAGAACAG
Chromosomal Coordinates Chr X from 79262-76803
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator