Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATP12
Systematic Name YJL180C
Description Conserved protein required for assembly of alpha and beta subunits into the F1 sector of mitochondrial F1F0 ATP synthase; mutation of human ATP12 reduces active ATP synthase levels and is associated with the disorder ATPAF2 deficiency
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATP12	6322281 upstream sequence, from -1000 to -1, size 1000
GGTAAGGATGGTGACAGCGAGGGGAAAAAGCCAGCTAAGAAGGCAGGCGGGACTTCGTGG
TTCACTTGGTTATTCCTATACGCTCTACTGTTTACATTGATATACCTGATGGTTGTATCA
TTCTTGAATACCAGAGGAGGCTCTTTTCAAGATTTCCGTGCTGAGTTCATTCAACGTTCT
ACTCAATTTCTCACTTCCTTACCTGAATTCTGCAAGGAAGTGGTTTCGAGAATCTTAGGC
AGAAGTACCGCCCAAAGAGGCGGTTATAGCGCCGTTTAAATAAGTTTACTGGCTTACAAT
TCGATATTTTTGCAACAGCAGTGCTAACCTTTTATTATATTTATATAAACTCTAAGCTTT
TATATCTACATTATACTAATAAAAAAAACTTGTTCCCGTAGTAAGTTTTCCGGCTAAGAA
AGGAAAGGCTATTGCCGCTTTCTTTTAATTCTTCATCAATGCCTTTAGATTGTCTATTGT
TTTTTCAACAGTAGTTTCTAAATAGTTCTTCTTTATCTTTAATGTTTTTCTTTGATCCAG
AAGAACAGTTTCGGCATGTGATAAATCATTAACGTATTTGGATTTATCCTGTAAGATAAA
CGATTTACCGCAAGATCTCCATACTTTGTCCGTTGGATAAGACTCTAGTTCTTTCTTTGT
CAATTCAGCAAGCTTTTCTTGTCTGTCCAAATATGCTAGCTGCTGATTGACCATATCCAA
TTGTGTCCTGGCGTTTCTTAAGCTCACTGTCATTTCTTGTGCTATCTGTGACATGTTTGT
AAGTATGTATTATTGATTCAATTTAGTAAAGAGCTCTGTAGATAGTTCTTTAATTCCCAT
CTGCTCATCTGAGAAATTTCTTCACTGTTACTTTTTAATTGCTATATCTTTAAACTCATT
CATTTTCTTCAGAGAAAAGAAAAAAATTAAGGTAAAGGAAAAGGCTAAATAAGAACAAAA
CACTTGAAGGCAAACGAAACCCTACAAAAGAGAATACGGA
Chromosomal Coordinates Chr X from 88560-87583
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator