Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERG20
Systematic Name YJL167W
Alias BOT3, FDS1, FPP1
Description Farnesyl pyrophosphate synthetase, has both dimethylallyltranstransferase and geranyltranstransferase activities; catalyzes the formation of C15 farnesyl pyrophosphate units for isoprenoid and sterol biosynthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERG20	6322294 upstream sequence, from -1000 to -1, size 1000
CCTGTTCGGCTCTTACGCCATAACCTTTATGCTTTGTTTTAAATATGGCTATCGGAGCGT
ACTGCTTCTTTTGAAATCTCTGATTTTGACAATCATTACCACAAGATGAACACAAATCGT
TGACACATTCTATCAACGTAAGTCTATTGATACAGTCAGAATCCTCGTCACAGGCATGGT
TGACGCCATCTGAGAATTCTTCATAACAGTCACATTCCATGAAATCATTATTCTTAAATG
TTCCGATCCTCTTGTTCGCATATATACAGTCATCCAAGTTTTCAAATTTGGTCAATGCTT
CCTCTGTGAGATCAGGCTCTTGATCAAAAAGCCTTTGAGGTTTATGGCCCTCAGCGTTGT
TATTCAGTATTTCTTTTTCATCTTCCGACGCACTCACACTTTGGTTCTTCGACATGATCA
CGTAAAACAACAACCAGGAAAGGAGAAAGGTTTGACAGCACGACTATGCAGTTTTCTATC
ACACGTTCGAAAGCCCCTTTGAAAAGCTGCCAACGTGACCTTACGTTCTGATAAATAACC
ACCAAATTACCAATAATTCTAATAGTTTCTTGGAATTTTTCACATGTTTGCAGTGAATAA
AAAAAAAAAAACGTTAAAGGTGATATTGATCACGTGACAAATCTGTAAAAGTACGGATAC
TGTCCTTATTACTGCGATATACAGTGTGAGGTATTCTAAGCGGTATATTCACCGTCCTCT
ACACATATTTTAAATACTGATGAAGTGACAAGCAATATCATTGAGCATTCTTTTTTCAAT
AGTCGAAGTCAGCTTCTTCTCGTCGGTTCTAAACGAAACGCCTTGTTGAAAAAGACCGAT
AAATAGAGGAAGCAACGGCAGGAAATATATATAAACGCATGTCGAAACTAATACTTTATG
ATAGATTGTTCTTCTATCAGTTTTCATTTTAACTTTAAAAACTCAACCAACAGGTATTGG
ACTGACATAGGCACAATAAACTCAAAAATATTACGTAGAA
Chromosomal Coordinates Chr X from 105014-106072
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator