Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name JJJ2
Systematic Name YJL162C
Description Protein of unknown function, contains a J-domain, which is a region with homology to the E. coli DnaJ protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL162C	6322299 upstream sequence, from -1000 to -1, size 1000
AACTATGATTCCAATGGCAGTAGTTATTACCATTTCTAGCGAAAGGATCACTCTAGACGA
TATAAGTTTAAAATTTGTTGATGTAATTAGAGGTGTAGTCGTCTAGAAGAAGATATGGCA
TGTAATGTTTTGAATTTACCTCATCTAATAGCAGGAACACAGGTTTTTTGCAGAACAGAG
AGGCATTTCTGGTATAGTTAAGATGTGGGAGAGGGACAAAGGCAGATTTGGAGGTGCAAG
AAATTTGTCGTGGTTAGCGACTAGCATTGTGTTAAGTTTCGCATTGTATTGATTTTATAA
GGGATGTATTGCATTCGGCTAAGGCAACATTTATGGATAACGAAGTGCGGTTGAGTTCTG
GTATCGGTTTTGAGAGAGTCTCTGTTGCTGTTAAGATTCCAATTTACATATCTGTCCTGC
ACAGGTTAGCGCTGCGGCGTTGCACAGGCATGAAACTAGGAAAACGTACTTTGGGCAGAT
TTGTAAAAAAAATTCTATCAAAACAACTAGTACAGAACAGTTGAGTTTAGAGCCGGTGTC
TATTATCATATGGGAAAGATGATCCTCTTGTTAATTTGGTAAGTAGTACTATTAGGTGTT
GAATATTAACCGTTTATAATCCGATATAGTGTAACGGCTATCACATCACGCTTTCACCGT
GGAGACCGGGGTTCGACTCCCCGTATCGGAGTATTTTTTATGTGATTAGCTAAATAGTTA
TTTTTTGAAATAGTTTGTAGTAGTTCACCTTTATCCTATTAAAATATAATATCACACGAA
AATTATCTGTTTGTCCTCAATTCAGTTGATCATTGTGCTAGATGTTCAATATTGTGAAAC
TTTTACAATACCGATTCGGTGCGGACATCTTGAAAATACAATACCGTGCGATGCCTTTAA
ACTTTTTTTGAGGCATGAGCGTAAATAGACCTGGAATGTTCAATATAGACTGTAGCAAAG
TGCTTCTTCAGTTTATGCTATTGTACACTGTACTATTCTT
Chromosomal Coordinates Chr X from 115629-113878
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator