Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPB4
Systematic Name YJL140W
Alias CTF15
Description RNA polymerase II subunit B32; forms two subunit dissociable complex with Rpb7p; involved in recruitment of 3'-end processing factors to transcribing RNA polymerase II complex and in export of mRNA to cytoplasm under stress conditions; also involved in translation initiation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPB4	6322321 upstream sequence, from -1000 to -1, size 1000
ACTGGAAAGGATTTGGGGCAGGTGCCCTGGCTGGAGGTACAACGAGACTAGATTTACGTC
GTCTGTACGCATCTAGACTTTCGTTACTGTTTAAGTCATCGTATTGAGGGGGATACACCA
GGTTTTGTTGAGAATTAGTTACTTTTTCCTCATTCCAAGGGTTAACAAAGCAAAATTGAG
AATTCTGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGGTGATGATTCTGATGCTGCT
GCTGTGGAGACCTTTGAGAGCCTTGATTTACGTACGATGGATTCCATATACCTCTCCCCA
TATGGCTATTGTCTGGGCTTGCTCTACCCGAGCCCATACTAGCATCACTGTGGGTCACAA
GGGTCGGGCTCAAGGAGTTATTCATGTTGCTATTGGAGCTGGACGAGTCGTTATTATTGG
ATGAGTTCATGATTGCTCAAATTAGCATGTGAAAAAAAGATAACGAAATTATGTTCCCTT
GCACAATGGCTGTTGCTCTTCACCAAAATTCTTCTTTCGATATATTCCCAAATCTAATAG
TGAGAAATTTGTGTAATACCCCCAGTAATGGCCCACCAATTGTTTCCTTATATCTGTTTA
GCATTGCGACTCATTCATTGTTCAGCCCAGAAGGGGTAAATCTGAGGAGGGGGCATTGCT
TGCAATGGTTCAGAAGGGGCGGTTAGGGTTAATAAAGCCATCGCGCTATTTTGATATTTT
TATTAGGCCTTTTATATTTTTTTTAGTTTTTTTCTCCAAATCCTAAATCCTTTTTAGGTG
TCATTTACGTGCAACGCGACAATAGTGATATTGTCATTCTTCAAACTTTTTGCAAGGTAG
CTATTAAACATACCTACACACATACGTACATGCTTAACGGTGAGACAAAAGTAAAGAAAG
AGACTTGAATGGGTTGCTGCATCTTAATAAGTTGAGTTTGAGGGCGAAAGTACACAAATA
TTCATCCGTATTGAAAATATATATATAAGAATATAGAAAA
Chromosomal Coordinates Chr X from 150961-151626
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator