Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TIF2
Systematic Name YJL138C
Description Translation initiation factor eIF4A, identical to Tif1p; DEA(D/H)-box RNA helicase that couples ATPase activity to RNA binding and unwinding; forms a dumbbell structure of two compact domains connected by a linker; interacts with eIF4G
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIF2	6322323 upstream sequence, from -1000 to -1, size 1000
CTGCGGTTCCAGACATCGGATGGCCTGACATGTTCAACACCGGTGTACTACTACTAATTC
CTGATTTAGATATGGCAACAAGTTTACAAGATTTTTTGATTAAAACTGTATCGATTGATG
GTGCTGATCAAGGAATCTTCAATCAATTTTTTAATCCTATTTGCAACTACAGCAAAGAGG
TTTTGCATAAGGTGTCTCCACTCATGGAATGGATACGCCTCCCCTTCACCTACAACGTAA
CCATGCCCAACTACGGATACCAGTCTTCACCAGCCATGAATTTTTTCCAACAACACATCA
GACTTATTCACTTCATTGGAACGTTTAAGCCATGGTCCCGTAATACAACTGACTATGACG
ACCACTATTACCAGCTGTGGAGAAGTACACAGCGTGAACTTTATAGTGAATGCCACTTAA
GTAACTACTTCACACACTTGCAATTGGGCAATATTGAAACAGAGACAAATTTTTACCACG
AACCTCCTTGTCTTCAAGACCTGTTGAATCATGGTAAAAGAGAAAATCAAAAGCACGTTG
ACCTGGATATAACCTCAGTAGATCGAAATGCTTCGCAGAAGAGTACTGCAGAGAAACATG
ATATTGAGAAACCGACATCTAAGCCGCAATCTGCTTTTAAATTTGATTGGGAGTCTACGG
ATTATTTAGACCGCGTCCAAAGAGCATTCCCAAAGCCTGATACCTGATGCCATCCCTCTA
CCTCTTAGCTATCAATCATTCAACTAAACTACTACATAGTATACATTAGCTGTACAGTCG
TCACATCAGACGAATACAAAAGGCCGGGTGAAAGCGTTGATTTTGCGTACCTTTTTCTTT
TTTTCGAAATTTTTTTATTTTTTTTTCAGCATCATATATAAAAGAAATCTCATCTCAAGG
AGAAGGAAACAGCAGATCCCAATACACATAGTAGGAAAAAAAAAGGTTCGCTAAACAAAG
GACTGGTGTGTACAAGAAACTAATAAATAGTAATTGCAAT
Chromosomal Coordinates Chr X from 154691-153504
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator