Yeastract IST IBB-BSRG INESC-ID
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS21b
Systematic Name YJL136C
Alias eS21, S21B, S21e, S26B, YS25
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps21Ap and has similarity to rat S21 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS21B	6322325 upstream sequence, from -1000 to -1, size 1000
AAGTAATTAGGCTCTTGAAAGTCATTGGGGTTAGAGAGAGTCCTGGCTCTTTTCCTAATG
TTCGAGGTATTCAGTCCATCTACCATTTTTTATCTATACAAATGGCTTGTGTCCGCTGGT
CTGGTAGGTTTGAAGAATTTCCTCTACGTGATGGTTGTATGTAAACAAACTTTCTTAAAC
TCTGCTTTTTCTTACTGCCCTTATAATGTGACGACAACTTTAGCGCAAGGTGAGGGAAAA
ACAAAACAGCCAAGCGTAGTTCAGTCACATGATAAAGGCAGTAGTTCAATTTGGTACTAA
GAAACATTTTTTGCAACATTTTTGCCTTGTTATTCGTGAAATGAATATCTGGCGATATTT
TGCACATATTTGGTTCCAACAATAGCTGGTTGAACATACATCTACTTAAGTTCTCTCTTC
TTTTTTTTTCTCTTTCACTTTTCTACATATGTACTGTTGCCATAGTAACGTAAATTATGT
AAAATACTTATCCGCATCAGGGACTGAGAGTCCAAAACGTAGGCTTGAAAAACCAAAAAT
AATGCAACAAGTAGCATAATAAAATGGGACAAAGAAAGCACTATCGAGGTTGTATCCGTG
TTTCTATATAGGAGTGAAAACTTCTGGGGAGATTACCTTTTGACGACAATGTGTTTACAC
CCGTACACTTTATACATCCATACATCTCCATAACTTTTAAGGAATGAAATAAATGCTTTA
TGTTTCGCCGCGTCTCTCGCCGGGAGCTGGTGGGCACGCTTCGAGCGAGTTCGCTAGTGA
GACCACTGCCTTTATTCTGGTTCTCTTCATCGGTGGTGGGAACCATACCAGCTGGCTAGT
GGGTCCGTTTGAAGCGAATCTCGGCTCTGTATAATGTAAGAACTAGTAATTGAGGATTAT
AGGATTGAAAGTTTTATAAACATTGTTAACGAATTTGACTTTAAAGGGGAATTTCAGTTA
AAAATCTGATAAAAAAATAAAAGAATATCAATAAGCCAAA
Chromosomal Coordinates Chr X from 156789-156550,157273-157250
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator