Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS21b
Systematic Name YJL136C
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps21Ap and has similarity to rat S21 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS21B	6322325 upstream sequence, from -1000 to -1, size 1000
AAGTAATTAGGCTCTTGAAAGTCATTGGGGTTAGAGAGAGTCCTGGCTCTTTTCCTAATG
TTCGAGGTATTCAGTCCATCTACCATTTTTTATCTATACAAATGGCTTGTGTCCGCTGGT
CTGGTAGGTTTGAAGAATTTCCTCTACGTGATGGTTGTATGTAAACAAACTTTCTTAAAC
TCTGCTTTTTCTTACTGCCCTTATAATGTGACGACAACTTTAGCGCAAGGTGAGGGAAAA
ACAAAACAGCCAAGCGTAGTTCAGTCACATGATAAAGGCAGTAGTTCAATTTGGTACTAA
GAAACATTTTTTGCAACATTTTTGCCTTGTTATTCGTGAAATGAATATCTGGCGATATTT
TGCACATATTTGGTTCCAACAATAGCTGGTTGAACATACATCTACTTAAGTTCTCTCTTC
TTTTTTTTTCTCTTTCACTTTTCTACATATGTACTGTTGCCATAGTAACGTAAATTATGT
AAAATACTTATCCGCATCAGGGACTGAGAGTCCAAAACGTAGGCTTGAAAAACCAAAAAT
AATGCAACAAGTAGCATAATAAAATGGGACAAAGAAAGCACTATCGAGGTTGTATCCGTG
TTTCTATATAGGAGTGAAAACTTCTGGGGAGATTACCTTTTGACGACAATGTGTTTACAC
CCGTACACTTTATACATCCATACATCTCCATAACTTTTAAGGAATGAAATAAATGCTTTA
TGTTTCGCCGCGTCTCTCGCCGGGAGCTGGTGGGCACGCTTCGAGCGAGTTCGCTAGTGA
GACCACTGCCTTTATTCTGGTTCTCTTCATCGGTGGTGGGAACCATACCAGCTGGCTAGT
GGGTCCGTTTGAAGCGAATCTCGGCTCTGTATAATGTAAGAACTAGTAATTGAGGATTAT
AGGATTGAAAGTTTTATAAACATTGTTAACGAATTTGACTTTAAAGGGGAATTTCAGTTA
AAAATCTGATAAAAAAATAAAAGAATATCAATAAGCCAAA
Chromosomal Coordinates Chr X from 156789-156550,157273-157250
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator