Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SPT10
Systematic Name YJL127C
Alias CRE1, SUD1
Description Putative histone acetylase with a role in transcriptional silencing, sequence-specific activator of histone genes, binds specifically and cooperatively to pairs of UAS elements in core histone promoters, functions at or near the TATA box
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPT10	6322334 upstream sequence, from -1000 to -1, size 1000
ATGTGATTGTTTCTCCCACTCTGGATCACTGAGATCGTGCATTCCAACCTGCCCTGGCAT
GAGCACATAGCATTGAGTGTCAACCGCTCTTGCTCTGCCTAGTAACTCCCAATGTGCTTC
CCCTGTTTTAATAGTGAACGCACTGGGAAAACATAAGATTTCAGCCCCCATTGATCGTAA
TTTCAAAGAAAATTCGGGAAAGCGAATATCATAACAAATGGCACTGCCCAATTTTCCCAA
TGGAGACTCTATAATGTCAGGAATGGCTTTGCCAGGCTGGACAGATTTTGATTCTTTCAA
TATCGGTCCATTTGGCACGTCTACGTCAAACAAATGCAGTTTTTGGTATTCTTGCAATAT
TTTCCCTTCATGATCGATATATAATAGAACGTTTCTGACTCGATCATTGCCTTCAAGTAA
ATCTTGTTCTGAGGGCGGCAAGTGTACCCCAATGGAAACATCTATATTCCGTGAATTATC
TCTGACAAGGTCGGTAATGCTTGACTGTAATTGCCGAATAAATTTGGGGCTTTTCTGTGC
CAAATACCTGGAATGAAGAGGGTTTTGAGAAAGATAGTCACTTGCCTCAGGGAGAAAAAC
GACATCCGCCTTTTTTTGAATGGCTTCAGATATCAATTCTTTTACCACTTTTAAGTTTTT
GGTCAGGTCAGCGGATGAACATAATTGTGCGACAGCAACCCGTTTTAATTTACTAGTCAT
TTGCGGTGTTATATTTTATGAAGGAGACTTCATGATGGGTATGAATTTTATTTCACCTCT
ATTCATTTACTTCTAATGGCCTAGAATCTAGTAAGCTCTGAAAATTCGAGATGCGGATCG
TGAGCTAAAATAATAAAAAAATGAAAAATATAAAAGAGCAAAATTCATTACATTGGCGTT
AGTTCACTGCTCGGGGGATGAGTAAAAAGTGTACCGATCAAGAACAACTCTAGACTTCCG
CCAAAGTGATTATCAACAAAAATCGTAATAATTAGCTTCA
Chromosomal Coordinates Chr X from 184220-182298
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator