Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DPB11
Systematic Name YJL090C
Description Replication initiation protein that loads DNA pol epsilon onto pre-replication complexes at origins; checkpoint sensor recruited to stalled replication forks by the checkpoint clamp complex where it activates Mec1p; ortholog of human TopBP1
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DPB11	6322371 upstream sequence, from -1000 to -1, size 1000
CTTTCTGACAGAGAAATCAGTGATTGCGTTAGAGGAGCTTTGACCGGTTGGTACTATCAG
GACTTTATTGCTGCAGGAATCTGTATCATCGAGGGAATAAGACCTGCCATATTTCCTCTT
GGCCATCGTCTATTCAGAGTAGCGAGAAGAAAAAAAGAAGCAAAAAAAAAAAAAAAAAAC
GAGCAAAAGAAATCGAGCAAAGGAGAATGAGCAAAGGATAAACGGAAAACAATGGTAAAG
AGGATTAGCCGCTGAACTAGATTGTAAATTGAAGCGGAAAAGAAAACAAAGGAGAGGAAA
TCGGAGAGGCAGAAAGCTTTCTGCCTTATATACTTTTTTTTTTGCCGCCGAGTTCTGAGA
TCACGCCCTTAAATTTAGCCGCCAAAACACCGGTCGAACGGCGAAAATGGATCGGAGTCT
TGATTGCACCCACACCTCGCATTTTGTGCACTAACATAAAATATGACGAAGTGAGAGTCA
TGACACACAGAATAACTTAAAAATACTTGAGGAAAAAGTTCTCATATTATGAGGTCATAA
TAACTACATCGTTATTGTTGCGATATAACTTCAATGTTTTCTGCCTGCAAAAGAATCCTT
CCTTTTCCTTCTTTAATTGAAGAGTCCATGTAACCTTGTTTCGTTACTTATATTTATTCA
CCTTTCTACTTTAGTCACATAACGTAATCTGGGCATAATCATTGAGGTATCATTATTAGC
TTGAACTCGTGGTTCCTATTGTCGCCAGGTTTCTTTCAACGCATTTGCTCTTTCCGCTTC
GCATACGGCGGTGATCAAATGCAAAACTTACCCTCATCAGTATAAGAGAAGAAAAACTGC
ATGGACTATTCGCGTATTGCCTGGTAAAGCTATATAGTACTATTGGTAATGTTTGTACTG
TTTTATGTACATGATGAATAAGAAGAGACAAATTTTACGTGATATATAAGTCTTCTATTT
CTAGTATGGCAGGTATTTTATCAGTAGCATTAATATTACT
Chromosomal Coordinates Chr X from 265051-262757
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator