Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALY2
Systematic Name YJL084C
Alias ART3
Description Alpha arrestin that controls nutrient-mediated intracellular sorting of permease Gap1p; interacts with AP-1 subunit Apl4p; phosphorylated by Npr1p and also by cyclin-CDK complex Pcl7p-Pho85p; promotes endocytosis of plasma membrane proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL084C	6322377 upstream sequence, from -1000 to -1, size 1000
CACCTTTAGATGTCTCGGCCTCTCTGCGCTACCGGCATTGCCATTGGGGTGGGCATATCT
CTTGAAAGTAATCTGAGCAGCAGTTAAAGAATCTTGGAGAGCTTCCTTCGGCAATTCCAC
CACGGAGAGATTTCCGGAATGCTTTTTTTTGGGGAAATGCATTTATACAAACGTCAGGGC
GTGTATTCTCCGGCACTAAATCGACTCTTCCTTGTATAGGCCATCCCGCACTCTTCATCA
ATTACTAAAAAGGAACCAAATACGTCACTTTATAACCAATTTATTGATGTCGAACGGAGA
GCAACTCCCTTGCGCCATCTATCGCGCGCCGTCCCAAAAAGAAAAAAAGCAAAAAAAACA
TAATTTGAAGAAGGTTCTCTCAGCGGCTAACCTTTCTTCATTCTCAATTATAACAATAAT
GATACAAATACTGGCCCTGATCAATAGTTTGTCATGACAGCCGTTAAGACCAAACCATAT
TGCTGTAGTTCATCTCATCCCACTGTTTCATTCATCACCCAAAAATTCATCGCTCCTTTC
CCCAATACATATAACACCTTTTTCCTTTTTTAAATTAGTGACGCCTCTGTGAGAGGGTTC
AGTACCCATTCCTCCATGGCAACAACTCTCATTTCTCAACGCCTTCACCTATCACTCTTC
ACTGTCATTTCTTTTTGCTTTGTTATTCTGCTAAATGTCTTTCATTGGTTTTCCTTTATT
AAAACATTCTCTGGAGGATTTGCAGTTTCGGAAAAAAGAAATTTAATCCGATATGGTCCA
ATTTGGGAAAAAAAAAAGACTTGGCTAGTTCTCCTTTTCGTCTTTTAAGAATAGGTACTA
ATTACGCTACAAGCAGTCTGTGAGTATTGAGAGAGACTAAAAAGGGCAAATTAGTCTGTA
GACTTCGCTATTCATTACCGTTAGTCCTTTATTTTTTTAACGTTGAAACATCTTTTTTTT
TTTTCCAGCCTTTCTCATTGTAGATCAGTCATTTTTCAAG
Chromosomal Coordinates Chr X from 278002-274862
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator