Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BET4
Systematic Name YJL031C
Description Alpha subunit of Type II geranylgeranyltransferase required for vesicular transport between the endoplasmic reticulum and the Golgi; provides a membrane attachment moiety to Rab-like proteins Ypt1p and Sec4p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BET4	6322429 upstream sequence, from -1000 to -1, size 1000
TTATAGCTGACCTGCGCACCAACTTTATGATCGTTGGTAGAGAATGTTTTGAATTGAACT
ACTTCACCATCAGGTATCTCTTTACTATTGGAGTCGGCCCATTCTAACGGAACTTTAGCA
TCCGCGTCTGTATATGCAAGTACTGTGAATGTGTACCCACCTTCTTTTGTTAGTTCGGGC
AGAAAGGTAACGCTTGAGGTGATTTGCCTGATTAAAGCTCTGATTTGTGATTGTGTTGTA
TTTAAATCTACAACATCATCCTGCCCGTTGCTATTGCCAGAAATGTGTTGCACATTGAAG
GACCATCTTTCCACCACCTCTCCCTCATCCTTGTCTACAATACATAATACTAATTGATTG
CATTTTCCACCAAGAAGCCACCTGTGAACTTGTAGAAGAATTTTCCGAATGTAATCTTTC
AGTTCATCATCATGTGTCTTTAGTAACGTAAGATCGTACTTTTTCACCGTTACGAAATCT
TCTGCTGGGTATACGCCTCTTTGGTACAAAATGGAATTAATGCTGTACTCGAAAAATTCT
GTAACTGTCCTTGTTGAACCCTTTAGTGATATTGATTGTGACATTAAATGTGCTATTGGG
CCCCTTTGAAGTGGTTTTCAATACTCTTGTACGAGTATTTAACATCAATCATTCTTCGGG
GCGATTTCTATTCTTGAAATGTTAAATCATAAACCATACGTAAACATTTGAAAAAAATTA
AAGGCAAAAAAGAAAAAAACCACATTTTTGAGCCACATATACCTAGTATACTGAATTTAT
ACTATAAAGCAGTAGGTCAGCAATGGTATGTGCACTTCAAATGTTCGTTACATTATGAAT
TCTTTTTTTTACTGACTACCAAGCAATTTTTTATATTTGCCACATTAAACAGCATGGCAT
TAAAAGGAAACAGTGGACCAAGGAATTACTGAGACAAAAGAGAGTTCAAGACGAAAAGAA
AATATATGATTATAGAAGCTTGACTGAAAATGTTTTGAAT
Chromosomal Coordinates Chr X from 387348-386368,387438-387436
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator