Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name VPS53
Systematic Name YJL029C
Description Component of the GARP (Golgi-associated retrograde protein) complex, Vps51p-Vps52p-Vps53p-Vps54p, which is required for the recycling of proteins from endosomes to the late Golgi; required for vacuolar protein sorting
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPS53	6322431 upstream sequence, from -1000 to -1, size 1000
AGATCGCGCGATGTCAAGTAAATAAGCTTGTATTTGTATTTGTATGTGTTTATGTGTTTG
TGTGGTTGAGAATTTTATTTTCCTCCTAGTTTTTTCTTTTTTGAGTGCGGAGGGGCAGTG
CTCTAAACTTTGCCTGCTTCTTGTTCGACTTCGGCTTCCTATGCAGAACGCAAAATCGCG
TGCGCGAGGAACGAGGAAGACAACGCTTTAGATTGGCTTTTTCGTCGCCCATGCCCGTTG
CGATAGCGATATGATGAGAAATCGATAAAAGGTTGCACCAGTACACCGCACTTTCTGGCG
TGCTTGGATCTGGCTTGCGCGGCCTCGTGCCAGTAAGTAGAAAAGTAGTAATATGGCATG
GCGAAAGAGAACAAAACAAGCAAAGCAAGCGTAATGCACAGCTGTGGCTAAAAAAAGAGC
ACAGAGGTGAAGGGAAAAAAAGATAAAGAAATTAAGGAGGTTGAGAGGGCTTGTGTGTCG
ATGCTTGGTGAGGCGGGACGTAACGGTTTTTTGTCTGTAGGCACTTCTACCCCACAGGGC
CATGAATCTGGCCCGAAACCGTTGCGAGCGTGCCAATTGGTGGTGATATCTTTTTTCTTC
CCTTTTTTTTTGTTTTCCGTTCTGTTATGTTCCTTCATCTTGAATTCACTAAAGGGAACA
GAAGAAAAAGTTGGATATTAGATAAGCGGTACTTTTCTACAGGTCTAGTATTATTCCTCG
GTTGGAACAAGAAATAGTGCTTCAGTAGCTCAGTAGGAAGAGCGTCAGTCTCATAATCTG
AAGGTCGAGAGTTCGAACCTCCCCTGGAGCATATTTTTATACGTATATCTTTTTTCCCTC
TATTTTGTTTTTTTTTTCTTTGTTTTTTCGTAGCTAGTAAAGAAGAGAAGGAGACCTAAA
GTGTATATATACTTAATCTGCGATCATTGAAAAGTCGCTAGCTTATTGTCACTTACTGCA
TTTTCACAACATCTTCCATTTTTGTTTTCTCAGAAGGACA
Chromosomal Coordinates Chr X from 390853-388385
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator