Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RNR2
Systematic Name YJL026W
Alias CRT6
Description Ribonucleotide-diphosphate reductase (RNR), small subunit; the RNR complex catalyzes the rate-limiting step in dNTP synthesis and is regulated by DNA replication and DNA damage checkpoint pathways via localization of the small subunits
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNR2	6322434 upstream sequence, from -1000 to -1, size 1000
TTCTTTATCTTTTTTTCCCTTCACCTCTGTGCTCTTTTTTTAGCCACAGCTGTGCATTAC
GCTTGCTTTGCTTGTTTTGTTCTCTTTCGCCATGCCATATTACTACTTTTCTACTTACTG
GCACGAGGCCGCGCAAGCCAGATCCAAGCACGCCAGAAAGTGCGGTGTACTGGTGCAACC
TTTTATCGATTTCTCATCATATCGCTATCGCAACGGGCATGGGCGACGAAAAAGCCAATC
TAAAGCGTTGTCTTCCTCGTTCCTCGCGCACGCGATTTTGCGTTCTGCATAGGAAGCCGA
AGTCGAACAAGAAGCAGGCAAAGTTTAGAGCACTGCCCCTCCGCACTCAAAAAAGAAAAA
ACTAGGAGGAAAATAAAATTCTCAACCACACAAACACATAAACACATACAAATACAAATA
CAAGCTTATTTACTTGACATCGCGCGATCTTCCACTATTCAGCGCCGTCCGCCCTCTCTC
GTGTTTTTTGTTTACGCGACAACTATGCGAAATCCGGAGCAACGGGCAACCGTTTGGGGA
AAGACCACACCCACGCGCGATCGCCATGGCAACGAGGTCGCACACGCCCCACACCCAGAC
CTCCCTGCGAGCGGGCATGGGTACAATGTCCCCGTTGCCACAGAGACCACTTCGTAGCAC
AGCGCAGAGCGTAGCGTGTTGTTGCTGCTGACAAAAGAAAATTTTTCTTAGCAAAGCAAA
GGAGGGGAAGCACGGGCAGATAGCACCGTACCATACCCTTGGAAACTCGAAATGAACGAA
GCAGGAAATGAGAGAATGAGAGTTTTGTAGGTATATATAGCGGTAGTGTTTGCGCGTTAC
CATCATCTTCTGGATCTATCTATTGTTCTTTTCCTCATCACTTTCCCCTTTTTCGCTCTT
CTTCTTGTCTTTTATTTCTTTCTTTTTTTTAATTGTTCCCTCGATTGGCTATCTACCAAA
GAATCCAAACTTAATACACGTATTTATTTGTCCAATTACC
Chromosomal Coordinates Chr X from 392404-393603
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator