Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BBC1
Systematic Name YJL020C
Alias MTI1, YJL021C
Description Protein possibly involved in assembly of actin patches; interacts with an actin assembly factor Las17p and with the SH3 domains of Type I myosins Myo3p and Myo5p; localized predominantly to cortical actin patches
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BBC1	14627173 upstream sequence, from -1000 to -1, size 1000
TCAAAAAAGATCCAAAAAAATAAAAAACGAAGAAAAGGCCTCCATAGAAAATGTACGTCC
GCCACTTCAACTTCTTAGCTTCACCTGAACTTTCCAAGTTCTCTTCAAAGTCAGAATTAC
TTTCCAAATCGTAGCTGTCGGAATCGCTGTCTTCTATAAAACTCTTGTCTGCCTCATCTG
TATAGTCCTCGTCGCTATATCCGTCGGTCTCTTGTCCATTATCCTCAATGTACGGATCAT
CATCGTCGTCATCATTATGTTGGTCTAACGGAAAATCAAGATTTTTTTTGAACATTTCGT
ACGCGGAATCATTCTCTTTATCCATATCATAGTTGTCAGTTTCACCGCCATCGGTGTATA
TCCCTTTTTTGATGGCTCGTAGGCTAATCTCCTGTTCCCTATTCATTTTGTCCTTGAGGA
CATCTGCATACGCGGACTTTACAGCCTTATTGTAAGGCATTTGTTCATTAGCCGCTCCTG
CCTCTTCCCGCCTATGCTCATTTGAGTTATTCATTTCCAGCACTTCCAGGATAAAAGTTA
CTACCAACTGAAAACAAGAGAAACCGCCGTGAAACTATGGAGCACTACAGTTAAAACACC
ACTAACTCCACTCTGTTGACTTTTATCTGTAACTCCTCATGACAACCTTGTTGATAATTA
TCTCAAGATGACGATATTTACATTGTCATTATATTCCATTTTCGCGTCTCATATGTTACC
CGTATCAAAGAGTATAACCCTATCAATAAGTGATGTGTATCATTTATAAACCTCATATTT
TAAGAATAAACCTATATAATATAGGAATATACCCTGAAAATAGTTAGAGGTCTACAATGC
CCCTATTTTACCTCCAGAATTATAATCTCCTTAAGACTTCAACTAGAAGTGGTATTTACT
AGCACACTGTGAAACAGTAGCGTCAAGTCGGTAGTAAACATCAATCGCGTCCCAACTGCA
AGAGCTACTAGAAGTAAACACAGTCTTACCCAAACTAAGG
Chromosomal Coordinates Chr X from 402410-398937
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator