Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name OST1
Systematic Name YJL002C
Alias NLT1
Description Alpha subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes asparagine-linked glycosylation of newly synthesized proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OST1	6322458 upstream sequence, from -1000 to -1, size 1000
TTTTGTCATCATAACCAGCCACAATTATACCAGCAGTAAGGTTATCTTTATTTTCGTAAC
ATAATTCTTTGAACACCGAGGCAGCAGTCTCTGTGGAGGGGGTACCATATTGAGAAGTAT
ATAATTCCAAATGGTACTGAACAATGTCGGCAATCGCCTGCGTGTCTGCTGCAGAACCGG
ACCTACAACACCAAATTTTGTCATGTACTCTCGTTAATTTATCTGTCACACGGTTAGCTA
TGTACGCACCAGTGGTGGTACGTGAATCAGCACCTAGTATCACACCATCCTTAAATGTCA
CGGCCATACTATTTTATTAGGTGATTATAAGATACCTATTAGTTAGTAATAAGGCCAATT
GAGACTTTACTTCATTGAACTTTTAGAAACAATAAAGTGGGAGGAAAAATTCTTATATAC
ATACATTGAGGTACCTAAACTGACTTCGCCCTTTTTCAAACGATTGATGTCCACTTGAAT
TCCATTCATGTTAACTTTCTGTGTGTACTTTGAAGTAGCAATTCTTATCGTAATTGTACA
CCGTCTCGCAACTTGTTTAAAATACTGTTAAAGATTGCATTTCAATGCTTTTCCCTTTTT
TGCCACCGGATTCCGTTGCGAGTGGAAAAGTGAAAATGACAAAATTCAAAAGAAATCTAT
CAATATAACAAAAACGCCAAATCATCAAAAATGATCGGTGTTGAAGAGCTTGGCACTCTT
AAAGGCGGCTAGTTCATAATGCTATAGGAATTGACTCAAGGAAACGGACTATGTCTTGTA
CTGAATACTGTCTTCAATTGCCCATAGAATGCGTTAGTGTTACTCTTCTTCGCGAGCAGG
GTAAGTATGCGCGTAATGTTTTTTATTTTCTGAAAGGTTCAAAGTATGCAGAACAAATTA
ATGTTTGCTTTTTATTAAGCAAGCTACTTCTTTGACAAGTACCCGATTGCTTCTTTAGCT
CGGAACAAGACGCAAACTACAAAATATTGGTGCTGAAAAA
Chromosomal Coordinates Chr X from 434651-433221
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator