Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEC11
Systematic Name YIR022W
Description 18kDa catalytic subunit of the Signal Peptidase Complex (SPC; Spc1p, Spc2p, Spc3p, and Sec11p) which cleaves the signal sequence of proteins targeted to the endoplasmic reticulum
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC11	6322213 upstream sequence, from -1000 to -1, size 1000
CTATAGAAAGAGAGCGATCAGACCTGGTGGATTTTAATTGTAAACTGCAATCAAACATCC
TAGAACACCTACTATACGCGAAATGCCAAGGAGTGTACGTAACTTCTACCAATGAAAAAG
CTCGTTTGCTTGCAGCTGTCTGCAATCCTGAATTCATTGACACCTTCTGGTGCGAATTGA
CTCCCATAAGAGTCTCATTAAAGGAAAACCCTTCCATTTCTGTACCTCGAGAATATCAGA
TGTACGATCCGGTGGTACGTGCCACTATAAAGGAGGTTGTCACCAAGCGATTACTGCGAT
CCGCCTTCGATAATGACATCGACCCGCTAATGTGTCTTCATTTGGATAAAGGCTGGAAAC
TTAAATTCCCCATACTATCCTCGACAACGGGCCTAAACTTCTCCCTGAAGGATTGTCTTT
CCCTGGACACAGGAAAAGATGCATCTGATATGACAGAGGTGTTTCTCGCTACTATGGAGT
CGAGTAAAGTTCTTCGTACGTATAGCAACCTCGTTGACATTGTGATGAAGGACAATGGTA
GGTTGGACTCAGGCGTCCTAAAGCAATTCAACGACTACGTTAAGCAAGAAAAGCTCAATC
TACAACATTTTCAGGCCGGTTCCTCAAAGTTTCTCAAAGGCGCAAAGATATAATCCTCTT
ATATAGCATGTAAATAGAAAGTACGTAAAAAAAAGCTACTATTGACTTTATTCTCCGTGA
GGGCGGTTCTTTCTGTAGCTGTTGGTTTTTTCCAGATCTTATGTGACACACCTGCACAAC
AATGTCATTCTCTGTCAGCTGCAAGACTCCCAAGACCACGAAGCTGCTGGTATCTTCTAT
TTCAGAGAGCGCTGTTGCTCTTATTATTATTACCATACGTATACTTTTTTCCATTGGCAA
AAGCGATTTCAAAAAAATAATCTCCAAGGAAATAAATGGTGCAGAAACAATATACTACAG
AAATATACCGGAAAGTAAACCCCAAGGGAGTTAGCACAAG
Chromosomal Coordinates Chr IX from 398733-399236
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator